Shoot tips (the 1st and 2nd internode), young shoots undergoing primary growth (the 5th internode), secondary xylem and secondary phloem (the 30th internode), leaf and root tissues were harvested from three independent 3‐month‐old wild‐type Populus (Populus×euramericana cv. ‘Nanlin895’) grown in a phytotron (under a light and dark cycle of 16 h and 8 h, respectively). RNAs were extracted from samples above via the modified CTAB method and subjected to cDNA synthesis using Hieff™ First Strand cDNA Synthesis Kit (11120ES72; Yeasen, Shanghai, China). PtrCLE20 and PtrCLE41B transcript levels were determined via RT‐qPCR using UNICON™ qPCR SYBR® Green Master Mix (11198ES08; Yeasen, Shanghai, China) and analysed by the 2−△Ct method with the PtrActin1 housekeeping gene. To determine transcript levels of genes involved in PtrCLE20 signalling, vascular cambium cells were harvested from stems (the 9th internode) in wild type and both Line 32 and Line 51 of 35S::PtrCLE20 plants through laser microdissection method. RNA was extracted from the isolated vascular cambium cells and subjected to cDNA synthesis as described in detail in (Song et al., 2010 ). Three technical repeats were performed for each pair of primers. All primers used for RT‐qPCR were listed in Table S2 .
Unicon qpcr sybr green master mix
Manufactured by Yeasen
Sourced in China, United States
The UNICON® qPCR SYBR Green Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including SYBR Green I dye, to perform sensitive and reliable qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 96, by Roche (2 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Lightcycler 96 real time pcr system, by Roche (2 mentions)
Hieff first strand cdna synthesis kit, by Yeasen (1 mentions)
Ffpe rna kit, by Omega Bio-Tek (1 mentions)
Lightcycler 480 real time pcr system, by Roche (1 mentions)
Fastking gdna dispelling rt supermix, by Tiangen Biotech (1 mentions)
Quantstudio dx real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Hiscript 2 q rt supermix for qpcr gdna wiper, by Vazyme (1 mentions)
Myiq2, by Bio-Rad (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Abi stepone plus qpcr, by Thermo Fisher Scientific (1 mentions)
Trizol, by Solarbio (1 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Nanodrop instrument, by Thermo Fisher Scientific (1 mentions)
16 protocols using unicon qpcr sybr green master mix
1
Transcriptional Analysis of PtrCLE Genes in Populus
2
Profiling lncRNA Expression in HNSC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Different HNSC cell lines (HN4, HN6, HN30, CAL27, SCC9, and SCC25) as experiment groups were obtained from Department of Head and Neck Surgery, Shanghai Ninth People’s Hospital for qRT-PCR. Human oral keratinocytes (HOK) were set as the normal control group. Total RNA was extracted using RNA-Quick Purification Kit (RN001, YiShan Biotech, China) according to the manufacturer’s protocol. Then, reverse transcription of RNA into cDNA was conducted using the Fast All-in-One RT Kit (with gDNA Remover) (RT001, YiShan Biotech, China). We performed qRT-PCR in LightCycler 96 (Roche, United States) using Hieff UNICON qPCR SYBR Green Master Mix (11198ES03, Yeasen, China). The lncRNA expression levels of LINC02178, LINC01473, MIR3945HG, LRRK2-DT and AL137804.1 were detected. PCR primers were designed based on sequences from the corresponding genes (Table 1 ). All data were normalized using ActinB as the internal control by the Δ-CT method.
3
Quantitative Reverse Transcription PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells and virus were treated as described in the growth curve assay. The total RNA was extracted by TRzol reagent (Biomed, Beijing, China), followed by reverse transcription (M-MLV 4 First-Strand cDNA Synthesis Kit; Biomed, Beijing, China). The RT-PCR was conducted with primers of the tested genes (Table 1 ) by a Hieff UNICON® qPCR SYBR Green Master Mix (Yeasen, Shanghai, China). The PCR cycles were 95 °C for 3 min; 95 °C for 10 s, 59.8°C for 30 s, and 55°C for 5 s (40 cycles). Finally, a melting curve analysis was performed. The expression level of β-actin was used to normalize the difference in the expression of each target gene, and 2^-△△Ct was used to calculate the relative expression level of each gene.
4
Wnt5a Expression Quantification in Tumor Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tumor tissue by FFPE RNA kit (R6954-01; Omega Bio-tek, Inc., Norcross, GA, USA). And SuperMix was synthesized using Hifair II first-strand cDNA for RT-PCR (11123ES60; Yeasen, Shanghai, China). RT-PCR was performed on an Applied Biosystems ViiA 7 RT-PCR System (Applied Biosystems, Foster City, CA, USA) using UNICON® qPCR SYBR Green Master Mix (11199ES08; Yeasen, Shanghai). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. The relative gene expression calculated using the 2 ^ -ΔΔCt method. The expression level of Wnt5a in each sample was calculated. The primer sequences of the gene were as follows:
Wnt5a-forward: 5′-TCGACTATGGCTACCGCTTTG-3′
Wnt5a-reverse: 5′-CACTCTCGTAGGAGCCCTTG-3′
GAPDH-forward: 5ʹ-GGAGCG AGATCCCTCCAAAAT-3ʹ
GAPDH-reverse: 5ʹ-GGCTGTTGT CATACTTCTCATGG-3ʹ
Wnt5a-forward: 5′-TCGACTATGGCTACCGCTTTG-3′
Wnt5a-reverse: 5′-CACTCTCGTAGGAGCCCTTG-3′
GAPDH-forward: 5ʹ-GGAGCG AGATCCCTCCAAAAT-3ʹ
GAPDH-reverse: 5ʹ-GGCTGTTGT CATACTTCTCATGG-3ʹ
5
Validating Transcriptome and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the transcriptome data and gene expression patterns, we investigated the relative expression of eight DEGs. From each RNA sample, cDNA was synthesized using Hifair III First Strand cDNA Synthesis SuperMix with gDNA Digester Plus (Yeasen Biotech, Shanghai, China), following the manufacturer’s instructions, and used as a template (Lu et al., 2020 (link)). Primers for qPCR were designed using the Primer Quest Tool software1 (Supplementary Table 7 ) according to the transcriptome data. qPCR was performed on an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Wilmington, NC, United States) with UNICON qPCR SYBR Green Master Mix (Yeasen Biotech, Shanghai, China), and the reaction procedure was performed following the manufacturer’s instructions. The comparative CT method (2–ΔΔCT method) was used to quantify gene expression using the Cp18sRNA gene as an endogenous control (Zhang et al., 2021 (link)). Three technical replicates and three biological replicates were conducted for each sample.
6
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) was run in triplicate on the Light Cycler® 480 Real-Time PCR System (Roche, Switzerland). The qRT-PCRs were set up as follows: 5 μl Hieff UNICON® qPCR SYBR Green Master Mix (Yeasen, China), 1 μl cDNA template, 0.2 μl forward primer (10 μM), 0.2 μl reverse primer (10 μM) and 3.6 μl double distilled water, and were performed by the following conditions: 1 cycle of 95 °C for 30 s, 40 cycles of 95 °C for 5 s, 62 °C for 30 s, 72 °C for 10 s, followed by 1 cycle of 95 °C for 10 s, 65 °C for 60 s, 97 °C for 1 s. Primers are described in Supplementary Table 1. Elongation factor 1α (ef1α) was used as an internal reference housekeeping gene to normalize gene expression. Relative expression levels were calculated by comparing the expression levels of target genes against that of the housekeeping gene. Fold changes of expression were calculated by comparing the average levels of normalized gene expression of the experimental groups with those of the corresponding control groups.
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to obtain gene expression of certain proteins in cells and tissues, the total RNA was isolated with TRIzol Reagent and reverse-transcribed with FastKing gDNA Dispelling RT SuperMix (TIANGEN Biotech, Beijing, China). QRT-PCR was performed with UNICON® qPCR SYBR Green Master Mix (Yeasen Biotech, Shanghai, China) according to the manufacturer’s protocols. The sequences of primers were listed in Table 1 . GAPDH or β-Actin was used as the endogenous reference gene in all RT-PCR experiments. The quantification of gene expression was performed relative to an endogenous reference gene (GAPDH/β-actin) using the −△△CT method in the experiments [19 (link)].
8
Gene Expression Analysis of BC Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was applied to extract total RNA of BC tissues and the cultured cells according to the manufacturer’s instructions. Then RNAs were reverse transcribed into cDNA by HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China). qRT-PCR was performed using Hieff UNICON®qPCR SYBR Green MasterMix (Yeasen, China) in an QuantStudio™ Dx Real-Time PCR Instrument (Applied Biosystems, USA). The results were normalized to GAPDH. The primers for qRT-PCR were as follow: DPT (forward GGGGCCAGTATGGCGATTATG and reverse CGGTTCAAATTCACCCACCC); DNMT3a (forward ACGATTGCTAGACTGGGATAATG and reverse AGTAAGCAGGCCAGGTAGA); GAPDH (forward GGAGCGAGATCCCTCCAAAAT and reverse GGCTGTTGTCATACTTCTCATGG).
9
Quantitative Real-Time PCR for ABC Transporter Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in a MyIQ2 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using UNICON™ qPCR SYBR Green Master Mix (Yeasen, Shanghai, China), following the manufacturer’s protocol. Briefly, the qPCR reaction mixture (10 μL) included 5 μL SYBR Premix Ex Taq, 3.5 μL ddH2O, 0.5 μL each of forward and reverse gene-specific primers, which are listed in Table S1 , and 0.5 μL cDNA template. The qRT-PCR reaction was as follows: an initial incubation at 50 °C for 2 min and then 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The guanine-N (7)-methyltransferase gene (Nl18s) expression remained constant among all of the strains; therefore, the mRNA levels of the ABC transporter genes in tissues, different instars, and survived induction 3th instar nymphs were normalized to the level of expression of Nl18s. The 2−ΔΔCT method was used to obtain the relative quantifications [40 (link)]. Three independent biological replicates that included three technical replications were carried out for each test.
10
Quantifying Gene Expression in Lacrimal Sacs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For lacrimal sac tissues, total RNA was isolated by TRIzol reagent (Takara, CAT #9108) and then converted to DNA by PrimeScript RT reagent Kit (Takara, CAT #RR037Q). Quantitative PCR was performed using LightCycler 480 II (Roche, Switzerland) by UNICON qPCR SYBR Green Master Mix (Yeasen, CAT #11199ES03). Gapdh was used as endogenous control and gene expression level was evaluated by the 2 −∆∆Ct method. The primers used in this study are as follows:
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!