Nucleolin

Fisetin, mushroom tyrosinase, phenylthiourea (PTU), and α-MSH were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). Fisetin was dissolved in dimethyl sulfoxide (DMSO) as a stock solution at 50 mM concentration and stored at −20 °C. DMEM medium, fetal bovine serum (FBS), and antibiotic mixture were purchased from WELGENE (Gyeongsan-si, Gyeongsangbuk-do, Korea). Antibodies against MITF, tyrosinase, β-catenin, β-actin, and nucleolin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Peroxidase-labeled anti-rabbit and anti-mouse immunoglobulins were obtained from KOMA Biotechnology (Seoul, Korea). All other chemicals were purchased from Sigma grades.

Whole-cell protein extracts from HASMCs were prepared with cell lysis buffer (20 mM sucrose, 1 mM EDTA, 20 μM Tris–HCl, pH 7.2, 1 mM DTT, 10 mM KCl, 1.5 mM MgCl₂, and 5 μg/ml aprotinin) for 30 min. The protein extracts were quantified using the Bio-Rad kit (Pierce Biotechnology, Rockford, IL, USA). For Western blot analysis, lysate proteins were resolved on sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and transferred onto nitrocellulose transfer membranes (Schleicher & Schuell, Keene, NH, USA). Specific proteins were detected with an enhanced chemiluminescence (ECL) kit (Amersham Co., Arlington Heights, IL, USA) according to the recommended procedure. In a parallel experiment, cells were washed with ice-cold phosphate-buffered saline (PBS) and collected. Then cytoplasmic and nuclear proteins were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce Biotechnology). Antibodies against MMP-2, MMP-9, TIMP-1, TIMP-2, iNOS, COX-2, NF-κB p65, IκBα, nucleolin, and actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The peroxidase-labeled donkey anti-rabbit immunoglobulin and peroxidase-labeled sheep anti-mouse immunoglobulin were purchased from Amersham Co.

Full table and dilutions for each antibody used can be found in Supplementary Table 4. YB-1 (Abcam: Ab12148), G3BP1 (Santa Cruz: sc81940), TIA1 (Santa Cruz: sc-1751), TIAR (Santa Cruz: sc-1749), eIF4G (Santa Cruz: sc-11373), Nucleolin (Santa Cruz: sc-9893), eIF4E (Santa Cruz: sc9976), Fus/TLS (Protein Tech Group: 11570-1-AP), TDP43 (Protein Tech Group: 10782-2-AP), Vigilin (Santa Cruz: 2404C3a), DHX36 (Protein Tech Group: 13159-1-AP), and GRSF1 (Aviva: ARP40382-P050).

Macrophages lysates were resolved on polyacrylamide gels followed by transfer onto nitrocellulose membranes. Membranes were blocked with 5% milk/100 mM Tris–HCl, 150 mM sodium chloride, 0.01% (v/v) Tween 20 (TTBS) followed by incubation with antibodies against ALOX15 (Abcam, Cambridge, UK), ALOX15B (Cayman Chemical), ALOX5 (BD Biosciences), SREBP-2 (Cayman Chemical), or Nucleolin (Santa Cruz Biotechnology). For protein detection, the membrane was incubated with IRDye secondary antibodies (LI-COR Biosciences, Bad Homburg, Germany) in 5% BSA/TTBS. Proteins were visualized and when applicable densitometrically analyzed with the Odyssey infrared imaging system (LI-COR Biosciences).

To generate pCapsid-EGFP, cDNA corresponding to CHIKV capsid protein was amplified by PCR using primers CHIKCprotF (5′ GCGGCGCAAGCTTATGGAGTTCATCCCAACCC 3′) and CHIKCprotR (5′ CGCGGATCCGACTCTTCGGCCCCCTCG 3′) and cloned into pEGFP-N1 (TaKaRa Bio, Inc., USA). To generate pCapsidW-EGFP containing the tryptophan residue required for capsid protein autoproteolytic cleavage at the C-terminal part of capsid protein, primers CHIKCprotF and CHIKCprotWR (5′ CGCGGATCCGACCACTCTTCGGCC 3′) were used, and the obtained fragment was cloned into pEGFP-N1. pSP6-CHIKV-ZsGreen, a plasmid containing cDNA of a CHIKV variant expressing the ZsGreen marker protein, was constructed using a full-length infectious cDNA clone of the La Reunion CHIKV isolate LR2006-OPY1 as described previously (33 (link)). The oligonucleotides used in site-directed mutagenesis are listed in Table S1 in the supplemental material. Mutants were generated using a QuikChange II site-directed mutagenesis kit (Agilent Technologies, Inc., USA). Antibodies to nucleolin (Santa Cruz Biotech, Inc., USA), EGFP (BD Biosciences, USA), and actin (Santa Cruz Biotech, Inc., USA) were purchased from the respective suppliers. Monoclonal capsid protein antibody was made in-house and characterized as described previously (34 (link), 35 (link)). A cocktail of anticapsid monoclonal antibodies (1.7B2 and 4.1H11) was used for immunofluorescence.