Ssofast evagreen master mix

The differential mRNA expression levels of KI67 and P53 genes were measured using the Real-time PCR technique (RT-qPCR). This RT-qPCR (Applied Biosystem, QuanStudio 5) used cDNA as a template for differential mRNA expression analysis using Ssofast Evagreen Master Mix (Bio-rad, USA) and a specific primer for KI67 and P53 (Table-1). The RT-qPCR mix comprised 1 uL pair of primer, 10 uL Ssofast evagreen SYBR mix, 6 uL nuclease-free water, and 2 uL cDNA. In addition, the setting condition of PCR was initial denaturation at 95°C for 5 min proceeded by 40 cycles of 94°C for 30 s as denaturation, and 57°C for 30 s as annealing, extension, and data collection. The expression of the b-actin gene was used as a reference gene using the 2^-DDCt method for relative quantitative (RQ) analysis. Minitab software (Minitab LLC USA) analyzed the RQ data with statistical descriptive and t-test methods.

Total RNA was extracted from ankle joints using a monophasic solution of guanidine isothiocyanate and phenol according to the manufacturer's instructions (TRI Reagent, MRC). After removal of DNA remnants with DNase I treatment (Sigma-Aldrich), first strand cDNA was synthesized using 2 μg of total RNA and MMLV reverse transcriptase (Sigma-Aldrich). Templates were amplified with SsoFast EvaGreen Master Mix (Bio-Rad Laboratories) on the CFX96 real time PCR instrument (Bio-Rad Laboratories). Quantitative Real Time PCR (qPCR) was performed at 55°C for all genes (except: IL6 at 58°C) for 40 cycles. Specific primer pairs (Eurofins Genomics) were used for the quantitative expression as follows (sequences 5′ to 3′, sense and antisense): human RANKL: ACGCGTATTTACAGCCAGTG and CCCGTAATTGCTCCAATCTG; mouse RANKL: TGTACTTTCGAGCGCAGATG and AGGCTTGTTTCATCCTCCTG; human TNF: GAGGCCAAGCCCTGGTATG and CGGGCCGATTGATCTCAGC; mouse TNF: CAGGCGGTGCCTATGTCTC and CGATCACCCCGAAGTTCAGTAG; mouse IL-1β: ATCTTTTGGGGTCCGTCAACT and CCCTCACACTCAGATCATCTTCT; and mouse IL-6: TAGTCCTTCCTACCCCAATTTCC and TTGGTCCTTAGCCACTCCTTC. The samples were normalized to GAPDH expression (TTAGCACCCCTGGCCAAGG and CTTACTCCTTGGAGGCCATG). Relative expression was calculated as the fold difference compared with control values using BioRad CFX96^TM. For each experiment at least three biological and two technical replicates were used.

Four micrograms of total RNA from each transfection i.e pcDNA3-only, HBV-only, HEV-only, HBV+HEV was used for reverse transcription using 2.5 µM oligo-dT(18) (Thermoscientific, USA) in a 25 µl reaction containing 200 U superscript III enzyme (Invitrogen, USA), DTT 5 mM (Invitrogen, USA), MgCl₂ 1 mM (ABI, USA), dNTP 200 µM (ABI, USA) 1X RT buffer (Invitrogen, USA) and RNaseOUT 1 U (Invitrogen, USA). The reverse transcription was carried out in ABI 2720 Thermocycler (ABI, USA) with heat lid for 50 min at 42°C, and followed by inactivation at 85°C for 5 min. 5 µl of cDNA product was used for amplification in a 20 µl reaction containing 300 nM each of forward and reverse primers (Table 1), and 1X concentration of SsoFast EvaGreen master mix (Bio-Rad, USA). The reaction was carried out on a CFX96 real-time PCR machine (Bio-Rad, USA) with the following cycling conditions: Initial denaturation 98°C for 2 min; 40 cycles of 95°C for 30 s, 55°C for 30 s (with plate read) followed by a default melt curve. All genes were studied in triplicates and post read analysis for relative gene expression was carried out on Bio-Rad CFX manager software. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was taken as a reference gene (house keeping control) and pcDNA3 as control. The normalized fold change values for each gene was represented in a bar chart.

Genomic DNA was isolated from peripheral blood leukocytes using standard techniques. The High Resolution Melting (HRM) method was used to detect mutations and SNPs in TBX20 gene. The HRM primers were designed using Primer Select program (DNASTAR), which also evaluates that primers sequence do not form secondary structures during PCR that can increase the complexity of melting profile interpretation. The primers specificity was tested through PrimerBlast platform (NCBI). Primers were designed to amplify complete exonic sequences and small flanking intronic sequences (Table 1). Reactions were performed with a total volume of 20 uL (5 uL of Mili-Q water, 1.5 uL of each primer at 20 pmol/uL, 10 uL of SSoFast Eva Green Master Mix (Biorad), and 2 uL of DNA at 150 ng/uL). The amplification parameters were 95°C for 4 minutes, 30 cycles of 94°C for 30 seconds annealing temperature for 30 seconds, and 72°C for 30 seconds, followed by a final extension step of 72°C for 5 minutes. For melting curve analysis, the parameters were 95°C for 30 seconds and 75°C for 30 seconds. Data were collected over a temperature range of 75–95°C in 0.1°C increments every 10 seconds.

RNA was collected using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions and stored at -80°C until further use. RNA concentration was determined using NanoDrop One^C (ThermoFisher) and 500 ng of RNA was reverse transcribed using qScript XLT cDNA SuperMix (QuantaBio) using a combination of random hexamer and oligo dT primers, according to the manufacturer’s instructions. Depending on starting concentration, cDNA was diluted between 1:10 and 1:20 for qPCR experiments and SsoFast EvaGreen Mastermix (Biorad) was used to amplify cDNA. The ΔΔquantitation cycle (Cq) method was used to determine the fold change in expression of target transcripts using HPRT as a housekeeping control gene. Variance in the mock or empty vector samples was calculated by dividing the ΔCt value of a single replicate by the average ΔCt value of all replicates for that specific gene and condition. qPCR primer sequences can be found in Table 4.