Kapa sybr fast qpcr master mix

Total RNA in OSCC cells was purified using TRI reagent (9424; Sigma‐Aldrich) according to the manufacturer's instructions. The total RNA was reverse transcribed into complementary DNA (cDNA) using RT‐PCR kit (PCRBIOSYSTEM), which was analysed using KAPA SYBR FAST qPCR Master Mix and CFX Connect Real‐Time System (BIO‐RAD). The 2^−△△Ct method was used to calculate the relative mRNA expression levels and the level of glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) expression was used as the internal reference gene. Four independent experiments were conducted. The sequences of primers used in this assay were listed below:
ICAM‐1 (Forward: 5′‐ACCATCTACAGCTTTCCG‐3′; reverse: 5′‐TCACACTTCACTGTCACC‐3′); VCAM‐1 (Forward: 5′‐ATGCCTGGGAAGATGGTCG‐3′; reverse: 5′‐TCTGGGGTGGTCTCGATTTTA‐3′) and GAPDH (Forward: 5′‐ACAGTTGCCATGTAGACC‐3′; reverse: 5′‐TTGAGCACAGGGTACTTTA‐3′).

SYBR 202 real-time PCR assays to detect scrub typhus were also used for comparison with the ICT AgTK. DNA was extracted from individual plasma samples of Nan Provincial hospital using Bacteria Genomic DNA Kit (Presto™ Mini gDNA Bacteria Kit, No. GBB100, Geneaid Biotech, Shilr District, New Taipei City, Taiwan) following the manufacturer’s instructions. Real-time PCR could not be used for analyses of the first or third sample sets. SYBR real-time PCR assays were used for the specific detection of the gene coding for the GroEL of O. tsutsugamushi. The primer pair were: F: TAA TTG CTA GTG CAA TGT CTG CGT T and R: CCA AAG TCA CGA TCA GCT ATA CT. The PCR reaction mixture contained 200 nM each primer, 1 µL of DNA template, 10 µL of master mix (KAPA SYBR FAST qPCR Master Mix) containing SYBR green, Taq polymerase, 4 mM MgCl₂, dNTPs and distilled water to a final volume of 20 µL. The PCR reactions were carried out and analyzed using real-time thermocycler (CFX96 Touch Real-Time PCR Detection System, BioRad, Hercules, CA, USA) with an initial temperature of 95 °C for 3 min, followed by 40 cycles at 95 °C for 3 s, 55 °C for 30 s and 72 °C for 20 s, with fluorescence monitoring at the 55 °C annealing step on a predetermined SYBR channel. Melting curve analysis was performed with increment of 1 °C/step (72–95 °C) to determine the change in peak fluorescence over time (dF/dT).

RNA extraction was performed using Nucleospin RNA kits (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) according to the manufacturer's protocol. Quantitative real-time PCR was performed using the CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with the KAPA SYBR^® FAST qPCR Master Mix. Actin or 18sRNA were used as internal controls. The primer sequences used for qPCR are provided in the supplementary information (Supplementary Table 6).

RNA extraction was performed using Nucleospin RNA kits (MACHEREY-NAGEL GmbH & Co.) according to the manufacturer’s protocol. Quantitative real-time PCR was performed by CFX96 Real-Time PCR Detection System (Bio-Rad) with KAPA SYBR® FAST qPCR Master Mix. Actin or 18sRNA were used as internal controls. The primer sequences used for real-time PCR are provided in the Supplementary Information (Table S6).