Plasmid DNA transfection was performed by Lipofectamine® 2000 manufacturer’s protocol. CA12 DNA (0.5 μg) or AE2 DNA (1 μg) was diluted in 200 μL of OPTi-MEM buffer (#31985–070, Invitrogen) and 4 μL of Lipofectamine reagent (#11668–019, Invitrogen) and was incubated for 10 min at RT in the darkness. Add transfection mix to the cells in serum containing medium and was incubated at 37 °C in a humidified incubator with 5% CO2 and 95% air. After further 6 h incubation, the medium was replaced with fresh DMEM containing FBS. The cells were cultured and used for experiment after 24 h of transfection.
Opti mem buffer
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom
OPTI-MEM buffer is a specialized cell culture medium developed by Thermo Fisher Scientific. It is designed to support the maintenance and growth of a variety of cell types in reduced serum conditions. The buffer provides a balanced formulation of nutrients, salts, and other components to facilitate optimal cell performance and viability.
Automatically generated - may contain errors
Lab products found in correlation
Dpbs buffer, by Thermo Fisher Scientific (2 mentions)
Cell counting kit 8 (cck8), by Enzo Life Sciences (2 mentions)
Opti mem buffer, by Promega (2 mentions)
Cytotox 96 non radio cytotoxicity assay, by Promega (2 mentions)
Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions)
Gene pulser xcell electroporation system, by Bio-Rad (1 mentions)
Fugene hd reagent, by Promega (1 mentions)
Jetprime buffer, by Polyplus Transfection (1 mentions)
Lsrfortessa flow cytometer, by BD (1 mentions)
C12fdg, by Thermo Fisher Scientific (1 mentions)
Annexin 5 fitc, by BD (1 mentions)
Bafilomycin, by Thermo Fisher Scientific (1 mentions)
Propidium iodide, by BioLegend (1 mentions)
Bodipy 493 503, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
9 protocols using opti mem buffer
1
Plasmid DNA Transfection by Lipofectamine
2
Efficient Transfection of HCT116 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HA & HA-SOCS1, sh & sh-SOCS1, and shTrx1 constructs were previously described [33 (link)]. The shSrc constructs were obtained from Sigma Aldrich (NM 198291.1 CCGGGTCATGAAGAAGCTGAGGCATCTCGAGATGCCTCAGCTTCTTCATGACTTTTTG). For transfection, HCT116 cells in 500 μl Opti-MEM buffer (Invitrogen) were mixed with 5 μg each of pcDNA-HA, HA-SOCS1, shRNA vectors and shRNA against SOCS1, Src and Trx. The cell mixture was transferred into a 4 mm electrode gap cuvette and transfection was performed using Gene Pulser X cell electroporation system (Bio-Rad, Herbercules, CA).
3
Dual-Reporter Transfection Optimization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection complexes were prepared by transferring nanoluciferase DNA substrate and pcDNA3.1(+)-Firefly[CMV/luc2] plasmid generated by gene synthesis (GeneWiz) into jetPRIME buffer (Polyplus) at a ratio of 100–1000 ng nanoluciferase DNA substrate: 400 ng Firefly plasmid: 80 μL jetPRIME buffer for every 200 000 cells. jetPRIME reagent was later added at a ratio of 2 μl per 1 μg DNA, each tube was vortexed for 5 s and incubated at room temperature for 10 min. Transfection complexes were added to cells while in suspension just before seeding. 10 000–20 000 cells were seeded per well in a white 96-well microplate (Costar 3610 or Porvair 214006) and incubated for 16–24 h at 37°C.
For U-2 OS Flp-In T-REx GFP-POLQ cells, transfection complexes were prepared in Opti-MEM buffer (ThermoFisher) and transfected using FuGENE HD reagent (Promega) at a ratio of 3 μl per 1 μg DNA.
Unless indicated otherwise, lipofection was used to perform reporter assays.
For U-2 OS Flp-In T-REx GFP-POLQ cells, transfection complexes were prepared in Opti-MEM buffer (ThermoFisher) and transfected using FuGENE HD reagent (Promega) at a ratio of 3 μl per 1 μg DNA.
Unless indicated otherwise, lipofection was used to perform reporter assays.
4
Murine Mast Cell Isolation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Murine MCs were harvested by peritoneal lavage as follows: naive mice were sacrificed by cervical dislocation and 5 mL of lavage buffer (2 mM EDTA, 0.25% BSA in PBS) was injected into the peritoneal cavity and incubated for 3 min prior to collection. MCs were identified within the harvested cell suspension as described in the flow cytometry section using a LSR Fortessa flow cytometer (BD Biosciences) and FlowJo software (TreeStar) and subsequent parameters were analyzed. To quantify MC senescence, cells were incubated in suspension in OptiMEM buffer (ThermoFisher Scientific) containing 100 nM of Bafilomycin (ThermoFisher Scientific) for 1 h at 37°C in order to increase the intracellular pH. The cell suspensions were then supplemented with 33 μM of C12FDG (ThermoFischer Scientific) for 2 h prior to analysis of C12FDG MFI. MC apoptosis was assessed as previously described (Asai et al., 2001 (link)). Briefly, peritoneal cells were stained with fluorescently labeled primary mAbs as described in the flow cytometry section and incubated with 500 μl of Annexin V binding buffer (140 mM NaCl, 2.5 mM CaCl2 and 10 mM HEPES at pH 7.4) containing 5 μl of FITC-Annexin V (BD) and 5 μl of propidium iodide (Biolegend) for 15 min. Apoptotic cells were defined as Annexin-V+/propidium iodide-. MC granularity was assessed using the flow cytometric side scatter profile.
5
Bacterial Labeling with Vybrant Dyes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Vybrant dyes DiI, DiD and DiO (catalog number V22889, LifeTechnologies, USA) were used to label purified bacteria. The dyes were stored in their commercial buffers at 4 °C. Purified bacteria were resuspended in 100 μl of the commercial Opti-MEM buffer (catalog number 31985062, ThermoFisher Scientific, UK), and the dye was added at a dilution of 1/100 (final concentration of 100 μM). Samples were incubated at 35 °C for 30 min, then washed by pelleting two times and then resuspended in DMEM + 5% FBS.
6
Cytotoxicity Assessment of cp-asiRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 5
To test the cytotoxicity of cp-asiRNAs, MNT-1, a human melanoma cell line, and HaCaT, a human keratinocyte cell line were treated with cp-asiTYR #4-1 and hydroquinone.
The cp-asiRNA was incubated at 95° C. for 2 minutes and at 37° C. for 1 hour in OPTI-MEM buffer (Gibco). Proper strand annealing of the potential cp-asiRNAs was confirmed by gel electrophoresis.
One day before treatment with cp-asiRNA(4)-1, 5.0×103 MNT-1 cells or 1.0×104 HaCaT cells were seeded into 96 well plates. Immediately before treatment, the cells were washed with 1×DPBS buffer (Gibco), and then cultured in the presence of 1 μM or 3 μM of cp-asiRNATYR(4)-1 in OPTI-MEM buffer for 24 hours, at which point the cytotoxicity level was measured using a CytoTox96 Non-Radio Cytotoxicity assay (Promega) according to manufacturer's instructions. The media was then replaced with the serum-containing media and cell viability was measured using a cell counting kit-8 (Enzo) according to manufacturer's instructions.
As shown in
7
Porcine Granulosa Cell Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Control siRNA (siCTR) or negative control siRNA (NC), and nine validated siRNAs against porcine c-Jun, beclin1, and Atg5 were designed and synthesized by GenePharma (Shanghai, China). Their sequences are shown in Table 2 .
GC mass were washed thrice with phenol red-free Opti-MEM buffer (Gibco, 31985070), and centrifuged for 5 min at 270 × g. The cells were suspended in electroporation buffer, transferred to a 4-mm gene pulsar cuvette (Bio-Rad) with siRNAs and maintained for 5 min at 4°C. The GCs were electroporated at 120 V, with 8 pulses using the BTX ECM 830 electroporator (BTX, United States). Immediately after electroporation, the cells were maintained in a cuvette for 10 min and then suspended in 2 mL of pre-warmed DMEM/F12 containing 3 mg/mL BSA. The cells were transferred to a 35-mm culture dish (Nunc, 174904) and incubated at 37°C for 2 h before further use.
Adherent porcine GCs were transfected with siAtg5 and siBeclin1 using the LipofectamineTM 3000 Transfection Reagent (Thermo Fisher Scientific, L3000008) according to the manufacturer’s instructions. After 6 h of transfection, the cells were treated with FSH for 24 h. Then, the medium was collected for the progesterone assay and the cells were fixed with 4% paraformaldehyde for BODIPY 493/503 (Invitrogen, D3922) staining.
GC mass were washed thrice with phenol red-free Opti-MEM buffer (Gibco, 31985070), and centrifuged for 5 min at 270 × g. The cells were suspended in electroporation buffer, transferred to a 4-mm gene pulsar cuvette (Bio-Rad) with siRNAs and maintained for 5 min at 4°C. The GCs were electroporated at 120 V, with 8 pulses using the BTX ECM 830 electroporator (BTX, United States). Immediately after electroporation, the cells were maintained in a cuvette for 10 min and then suspended in 2 mL of pre-warmed DMEM/F12 containing 3 mg/mL BSA. The cells were transferred to a 35-mm culture dish (Nunc, 174904) and incubated at 37°C for 2 h before further use.
Adherent porcine GCs were transfected with siAtg5 and siBeclin1 using the LipofectamineTM 3000 Transfection Reagent (Thermo Fisher Scientific, L3000008) according to the manufacturer’s instructions. After 6 h of transfection, the cells were treated with FSH for 24 h. Then, the medium was collected for the progesterone assay and the cells were fixed with 4% paraformaldehyde for BODIPY 493/503 (Invitrogen, D3922) staining.
8
Transfection and Culture of HEK293 and Primary Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells were obtained from ATCC (CRL-1573) and authenticated by STR profiling by the supplier. HEK293 cells were cultured in a 37 °C incubator supplied with 5% CO2. Transfection of the DNA was performed using polyethylenimine (PEI) (Polysciences: 24765). Brifely, the DNA and PEI were mixed and add to Opti-MEM buffer (Gibco: 31985070). After incubation at room temperature for 30 min, the mixture was added to the cultured HEK293 cells. The cells were grown for 2 days before experiments were performed.
Euthanasia of P0 pups were performed using decapitation after anesthetization on ice for 2 min. Hippocampal tissues from P0 pups were dissected and digested with 0.25% trypsin (Gibco, 25200072) at 37 °C for 12 min. Neurons were plated on glass coverslips precoated with poly-D-lysine and cultured at 37 °C in 5% CO2 for 14 days before the experiments. The cultured neurons were transfected with plasmids at 10 days in vitro (DIV 10) with calcium phosphate. Briefly, DNA and Ca2+ were mixed and added to HBS buffer. After incubation for 30 min at room temperature, the mixture was added to the cultured neurons, and incubation was conducted at 37 °C for another 30 min. After two washes with culture medium, the neurons were grown in an incubator for 4 days before experiments were performed.
Euthanasia of P0 pups were performed using decapitation after anesthetization on ice for 2 min. Hippocampal tissues from P0 pups were dissected and digested with 0.25% trypsin (Gibco, 25200072) at 37 °C for 12 min. Neurons were plated on glass coverslips precoated with poly-D-lysine and cultured at 37 °C in 5% CO2 for 14 days before the experiments. The cultured neurons were transfected with plasmids at 10 days in vitro (DIV 10) with calcium phosphate. Briefly, DNA and Ca2+ were mixed and added to HBS buffer. After incubation for 30 min at room temperature, the mixture was added to the cultured neurons, and incubation was conducted at 37 °C for another 30 min. After two washes with culture medium, the neurons were grown in an incubator for 4 days before experiments were performed.
9
Cytotoxicity Evaluation of cp-asiRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 5
To test the cytotoxicity of cp-asiRNAs, MNT-1, a human melanoma cell line, and HaCaT, a human keratinocyte cell line were treated with cp-asiTYR #4-1 and hydroquinone.
The cp-asiRNA was incubated at 95° C. for 2 minutes and at 37° C. for 1 hour in OPTI-MEM buffer (Gibco). Proper strand annealing of the potential cp-asiRNAs was confirmed by gel electrophoresis.
One day before treatment with cp-asiRNA(4)-1, 5.0×103MNT-1 cells or 1.0×104 HaCaT cells were seeded into 96 well plates. Immediately before treatment, the cells were washed with 1×DPBS buffer (Gibco), and then cultured in the presence of 1 μM or 3 μM of cp-asiRNATYR(4)-1 in OPTI-MEM buffer for 24 hours, at which point the cytotoxicity level was measured using a CytoTox96 Non-Radio Cytotoxicity assay (Promega) according to manufacturer's instructions. The media was then replaced with the serum-containing media and cell viability was measured using a cell counting kit-8 (Enzo) according to manufacturer's instructions.
As shown in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!