The largest database of trusted experimental protocols

4 protocols using tb green qrt pcr

1

RNA Extraction and qRT-PCR Analysis of BCa

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from the liquid nitrogen tissue samples of 16 BCa patients using the KZ-II grinder TRIzol reagent (Cat. abs9331-100ml, Absin, China) in an RNase-free atmosphere. The quality of total RNA was evaluated using a NanoDrop (Cat. #N60, Implen, Germany). Next, in a 20 ul total reaction volume using a PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Japan), the cDNA of mRNAs and lncRNAs was synthesized from the < 1000 ng of total extracted RNA, which was then amplified in a 25 ul total reaction volume with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus, Takara) using a CFX96 Real-Time PCR Detection System. Additionally, miRNA cDNA was synthesized from 250 ng < total RNA < 800ng in a 10 ul total reaction volume, and amplified in a 25 ul total reaction volume using Mir-X™ miRNA First- Strand Synthesis and TB Green™ qRT-PCR (Takara), according to the manufacturers protocol. The housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was used as an internal control to calculate the comparative quantification of gene expression levels via the 2-ΔΔCt method. All primers, the sequences of which are listed below, were synthesized by Sangon Biotech (Shanghai).
+ Open protocol
+ Expand
2

Quantifying Gene and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAiso reagent (TaKaRa, Japan) was used to extract the total cellular RNA, and PrimeScript™ RT kit (TaKaRa, Japan) was used to obtain the cDNA. SYBR Premix Ex Taq II real-time PCR kit (TaKaRa, JAPAN) was used to detect the mRNA expression of the gene. GAPDH was set as the internal control. For the miRNAs, Mir-X™ miRNA first-strand synthesis (TaKaRa, JAPAN) was used for reverse transcription, and TB Green™ qRT-PCR (TaKaRa, JAPAN) was used to amplify the cDNA. U6 was set as the internal control. The relative differential mRNA expression of each gene or miRNA was calculated by 2 -ΔΔCt . The primers for qRT-PCR are shown in Table S1.
+ Open protocol
+ Expand
3

Quantitative Analysis of miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissues or cells using Trizol (Takara, Japan) and cDNA prepared and subsequently quantitated using Mir-X™ miRNA First-Strand Synthesis and TB Green® qRT-PCR (Takara, Japan) performed on ABI 7500 qRT-PCR System U6 was used as the internal control for quantitative PCR of miRNA, while the beta-actin was used as internal control used for quantitative PCR of CCND2. 2-delta delta CT was used to calculate the gene level in each sample. The primers used in this study were listed below (Table 1).

Primer sequences used for qPCR

Primer nameSequences (5′–3′)
miR-93-5pF: GCCGCCAAAGTGCTGTTC
R: CAGAGC AGGGTCCGAGGTA
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
CCND2F: TTGTGATGCCCTGACTGAGC
R: CACGTTGGTCCTGACGGTACT
ACTINF: AGCGAGCATCCCCCAAAGTT
R: GGGCACGAAGGCTCATCATT
+ Open protocol
+ Expand
4

Quantitative Analysis of miRNA and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissues or cells using Trizol(Takara, Japan)and cDNA prepared and subsequently quantitated using Mir-X™ miRNA First-Strand Synthesis and TB Green® qRT-PCR(Takara, Japan performed on ABI 7500 qRT-PCR System U6 was used as the internal control for quantitative PCR of miRNA, while the beta-actin was used as internal control used for quantitative PCR of CCND2. The primer used in this study is listed below.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!