To prepare epithelial cell pellets, colons and ceca were incubated in PBS containing 30 mM EDTA and 1.5 mM DTT for 20 minutes at 4°C with occasional inversion. Tissue was subsequently transferred to PBS containing 30 mM EDTA, incubated for 10 mins at 37°C, and shaken vigorously for 1–2 minutes until the mesenchyme separated from the epithelium. The mesenchyme was removed and epithelial cells were pelleted at 1500 rpm for 5 minutes at 4°C and washed in PBS. In some cases, cell pellets were further incubated with dispase (Corning, 0.3 U/ml) in PBS (100 μL dispase per 50 mL PBS) at 37°C for 10 min and then quenched with 1/10 volume of FBS containing DNase (10 ul DNase per ml FBS) followed by washing in PBS. Cell pellets were flash frozen in liquid nitrogen and stored at −80°C until use. For ChIP-seq analysis, cells were cross-linked prior to freezing as indicated below.
Dnase
Manufactured by Corning
DNase is a type of enzyme that cleaves or breaks down DNA molecules. It is commonly used in various laboratory applications, such as DNA extraction, PCR (Polymerase Chain Reaction), and DNA purification.
Automatically generated - may contain errors
2 protocols using dnase
1
Isolation of Epithelial Cell Pellets
2
Spinal Cord Inflammatory Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spinal cord (L3–5) separated from rats in different groups under isoflurane anesthesia and collected in a frozen storage tube without RNase or DNase (1.8 mL; Corning). This tissue was stored in liquid nitrogen until further processing. RNA was isolated using TRIzol® Reagent (R0016, Beyotime) and purified with DNase I according to the instructions. Complementary-DNA was synthesized using the Reverse Transcription cDNA Archive kit (Bio-Rad, T100, USA). Expression of IL-1β, IL-6, NF-κB p65, and TNF-α was measured by the CFX96™ Real-Time System (Bio-Rad, USA) and TaqMan™ Gene Expression kit (RR047A, TaKaRa Biotechnology). A two-step PCR protocol was used to amplify and each step was based on instructions provided by the manufacturers. Data were collected and the quantification (Cq) was utilized to calculate the gene expression of IL-1β, IL-6, NF-κB p65, and TNF-α in all groups using GAPDH expression to normalize (2 − ΔΔCT method). Primer sequences are shown in Table 1 .
Primer sequences used for RT-qPCR
| Gene name | Sense primer (5′-3′) | Anti-sense primer (5′-3′) |
|---|---|---|
| IL-1β | TCCCAAACAATACCCAAAGAAG | ACTATGTCCCGACCATTGCTG |
| IL-6 | GACAAAGCCAGAGTCATTCAGAG | GGATGGTCTTGGTCCTTAGCC |
| NF-KB p65 | ACCTGGAGCAAGCCATTAGC | CCGCATTCAAGTCATAGTCCC |
| TNF-α | CTTCTCATTCCTGCTCGTGG | CCGCTTGGTGGTTTGCTAC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!