The largest database of trusted experimental protocols

Neb monarch pcr and dna cleanup kit

Manufactured by New England Biolabs
Sourced in United States

The NEB Monarch PCR and DNA Cleanup Kit is a laboratory product designed to purify DNA samples from PCR reactions or other enzymatic reactions. It efficiently removes unwanted primers, nucleotides, salts, and other contaminants from DNA samples, allowing for the concentration and recovery of purified DNA.

Automatically generated - may contain errors

2 protocols using neb monarch pcr and dna cleanup kit

1

In vitro Transcription of Viral Genomic cDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Viral genomic cDNA templates for in vitro transcription (IVT) were PCR‐amplified using the PrimeSTAR GXL Premix (TaKaRa) according to the manufacturer's protocol and cycling conditions. The forward primer (sm125: CGTACGCGTTAATACGACTCACTATAGTC CTCTGCCCCCTTCTTGC) was designed to incorporate the minimal sequence (underlined) of the T7 promoter. The reverse primer (sm127: TTTTTTTTTTTTTTTTTTTTTGGCCCACAGGTCTTAT GGCCGACC) was appended with a 21‐nt polyT tail (underlined) for generation of polyA‐tailed in vitro transcripts. The amplified DNA templates were cleaned using NEB Monarch PCR and DNA Cleanup Kit (NEB) and 1µg used for each IVT reaction. IVT was done using the NEB HiScribe T7 ARCA mRNA Kit (NEB), modified by omitting the polyA tailing reaction step for transcripts.
+ Open protocol
+ Expand
2

Mosquito DNA Extraction and COI Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nucleic acid from homogenized mosquitoes was extracted individually, using the NucleoSpin DNA Insect Kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany), following the manufacturer’s instructions. The mitochondrial COI region was amplified using the primer combination LCO1490 and UEA8 (targeting a ~1000 bp long fragment) [29 (link), 30 (link)], and PCR reactions were performed with the Platinum II Taq Hot-Start DNA Polymerase kit (Invitrogen, CA, USA), using 0.5 μl of the enzyme, 2 μl of 10x buffer, 0.6 μl of 50mM MgCl2, 1–1 μl of the forward and reverse primer solutions (10 μM), 0.2 μl dNTP mix (Promega, USA), 14.7 μl nuclease-free water, and used 2 μl of the DNA extract as a template. The PCR protocol included 5 cycles with the following parameters: 30 sec at 94°C, 30 sec at 45°C, and 1 min at 72°C, followed by 35 cycles of denaturation for 30 sec at 94°C, annealing for 1 min at 51°C, and 1 min of elongation at 72°C, ending with a final extension step at 72°C for 10 minutes. PCR products were purified using NEBMonarch PCR and DNA Clean-up Kit (New England Biolabs, USA), following the manufacturer’s instructions. The sequencing was processed by Eurofins Genomics Custom DNA Sequencing service (Eurofins Genomics, Germany).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!