Protocol detail

Macrophage RNA Isolation and qPCR Analysis

Find Similar Protocols

Macrophages were washed twice with cold PBS and lysed in RNA lysis buffer (QIAGEN or Zymo Research). RNA was isolated using RNeasy kits (QIAGEN) or RNA MiniPrep kits (Zymo Research). cDNA was prepared using first strand synthesis kits (Thermo) and qPCR was performed on an ABI StepOnePlus machine with SYBR reagents (Thermo). The following primers were used for qPCR analyses: Cox2-F: AACCGCATTGCCTCTGAAT; Cox2-R: CATGTTCCAGGAGGATGGAG (Nasser et al., 2012 (link)); Il1b-F: GCAACTG TTCCTGAACTCAACT; Il1b-R: ATCTTTTGGGGTCCGTCAACT (Huang et al., 2011 (link)); Abca1-F: CAGCTTCCATCCTCCTTGTC; Abca1-R: CCACATCCACAACTGTCTGG (Murphy et al., 2013 (link)); Abcg1-F: GTACCATGACATCGCTGGTG; Abcg1-R: AGCCGTA GATGGACAGGATG (Murphy et al., 2013 (link)); Itgb2-F: CCCAGGAATGCACCAAGTACA; Itgb2-R: CAGTGAAGTTCAGCTTCTGGCA
(generated for this paper).

Free full text: Click here

Thomas D.G., Doran A.C., Fotakis P., Westerterp M., Antonson P., Jiang H., Jiang X.C., Gustafsson J.Å., Tabas I, & Tall A.R. (2018). LXR Suppresses Inflammatory Gene Expression and Neutrophil Migration through cis-Repression and Cholesterol Efflux. Cell reports, 25(13), 3774-3785.e4.

Publication 2018

RNA lysis buffer RNeasy kits RNA MiniPrep kits first strand synthesis kits StepOnePlus machine SYBR reagents

Abca1 Abcg1 Buffer Cdna Cold Cox2 Il1b Macrophages Primers Synthesis

Top 5 similar protocols

Variable analysis

independent variables

RNA lysis buffer (QIAGEN or Zymo Research)
RNeasy kits (QIAGEN) or RNA MiniPrep kits (Zymo Research)
First strand synthesis kits (Thermo)
SYBR reagents (Thermo)
Primers for qPCR analyses: Cox2, Il1b, Abca1, Abcg1, Itgb2

dependent variables

MRNA expression levels of Cox2, Il1b, Abca1, Abcg1, Itgb2

control variables

Macrophages were washed twice with cold PBS

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!