and Src13-GCN4-eGFP/mCherry plasmids provided by Jay T.
Groves (U.C.
Berkeley) have been described previously.9 (link),10 (link) The
plasmid for the dopamine D2R measurements, pcDNA-D2s-L-Venus, was
obtained from Addgene (Cambridge, MA) and used without modification.
For construction of opsin-EGFP and opsin-mCherry, mouse opsin cDNA
was amplified by PCR and EcoR1 and BamH1 restriction sites were introduced
at the 5′- and 3′-ends, respectively, by using the following
primers: for the opsin-EGFP construct, forward primer GTGGGGAATTCGCCATGAACGGCACAGAGGG
and reverse primer TCTGGGGATCCGGCTGGAGCCACCTGG; for opsin-mCherry
construct, forward primer GTGGGGAATTCGCCATGAACGGCACAGAGGG and reverse
primer TCTGGGGATCCCGGGCTGGAGCCACCTGG. Amplified DNA was cloned into
pEGFP-N3 and pmCherry-N1 original vectors (Clontech, Mountain View,
CA), respectively. The functional relevance of these fluorescent protein
fusion constructs was demonstrated in previous work.7c ,18 (link)