Hepatic RNA Extraction and Quantification

Total RNA was extracted from frozen livers using ReliaPrep™ RNA Tissue Miniprep System (Promega), according to the manufacturer’s instructions, as described^{63 (link)}, genomic DNA contamination was removed using Ambion® TURBO DNA-freeTM DNase. 1 μg of total RNA was reverse transcribed with Superscript IV Vilo (Life Technologies) prior to qPCR analysis for mouse il2 (TaqMan Mm00434256, Life Technologies), ifng (TaqMan Mm01168134, Life Technologies), HBV core (forward TACCGCCTCAGCTCTGTATC, reverse CTTCCAAATTAACACCCACCC, probe TCACCTCACCATACTGCACTCAGGCAA). Reactions were run and analysed on Quant Studio 5 instrument (Life Technologies). For viremia quantification, a standard curve was drawn using plasmid DNA. All experiments were performed in triplicate and normalized to the reference gene GAPDH.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Bénéchet A.P., De Simone G., Di Lucia P., Cilenti F., Barbiera G., Le Bert N., Fumagalli V., Lusito E., Moalli F., Bianchessi V., Andreata F., Zordan P., Bono E., Giustini L., Bonilla W.V., Bleriot C., Kunasegaran K., Gonzalez-Aseguinolaza G., Pinschewer D.D., Kennedy P.T., Naldini L., Kuka M., Ginhoux F., Cantore A., Bertoletti A., Ostuni R., Guidotti L.G, & Iannacone M. (2019). Dynamics and genomic landscape of CD8+ T cells undergoing hepatic priming. Nature, 574(7777), 200-205.

Publication 2019

ReliaPrep™ RNA Tissue Miniprep System TURBO DNA-freeTM DNase Superscript IV Vilo TaqMan Mm00434256 TaqMan Mm01168134 Quant Studio 5 instrument

Dna contamination Dnase Frozen Gapdh Gene Genomic Ifng Mouse Plasmid Promega Tissue Viremia

Corresponding Organization :

Other organizations : Vita-Salute San Raffaele University, Istituti di Ricovero e Cura a Carattere Scientifico, The San Raffaele Telethon Institute for Gene Therapy, Duke-NUS Medical School, University of Basel, Agency for Science, Technology and Research, Singapore Immunology Network, Queen Mary University of London

Top 5 similar protocols

Variable analysis

independent variables

None explicitly mentioned

dependent variables

Expression of mouse il2 and ifng genes
HBV core gene expression
Viremia (viral load)

control variables

RNA extraction using ReliaPrep RNA Tissue Miniprep System (Promega)
Removal of genomic DNA contamination using Ambion TURBO DNA-free DNase
Reverse transcription of 1 μg of total RNA using Superscript IV Vilo (Life Technologies)
Normalization to the reference gene GAPDH

controls

Positive control: Not specified
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!