HeLa cells, Rpe1 cells, and tsBN2 cells were maintained as described previously16 (link),22 (link). Clonal cell lines stably expressing GFPLAP fusions were generated as described previously23 (link),24 (link). HeLa cells expressing mouse DHC-GFP were obtained from MitoCheck25 (link). GFP-LGN and DHC-GFP cell lines functionally complement depletion of the corresponding endogenous protein based on dynein recruitment and spindle orientation respectively (Fig. S5e, f ; data not shown). To inactivate RCC1, tsBN2 cells were cultured at 39.7°C for 1.5-3 hrs. mCherry-Ran T24N and mCherry-membrane targeting constructs (“Mem” from Neuormodulin; Clontech) were tested following transient transfection using Effectene (Qiagen). To generate the NuMA NLS mutant, the NLS sequence QQRKR was removed by PCR. For drug treatment, HeLa cells were incubated for 1-3 hrs with drugs at the following concentrations: STLC: 10 μM; Nocodazole: 100 nM (high dose), or 10-20 nM (low dose); ZM447439, 2 μM; BI2536, 10 μM; MG132, 20 μM; Thymidine, 2 mM.
RNAi experiments were conducted using RNAi MAX transfection reagent (Invitrogen) according to the manufacturer’s guidelines. Pools of 4 pre-designed siRNAs against LGN-GPMS2 (GAACUAACAGCACGACUUA, CUUCAGGGAUGCAGUUAUA, ACAGUGAAAUUCUUGCUAA, UGAAGGGUUCUUUGACUUA), p150-DCTN1 (CUGGAGCGUGUAUCGUAA, GAAGAUCGAGAGACAGUUA, GCUCAUGCCUCGUCUCAUU, CGAGCUCACUACUGACUUA), DHC-DYNC1H1 (GAUCAAACAUGACGGAAUU, CAGAACAUCUCACCGGAUA, GAAAUCAACUUGCCAGAUA, GCAAGAAUGUCGCUAAAUU), siRNAs targeting NuMA (GGCGUGGCAGGAGAAGUUCUU)9 (link) the three Gαi isoforms (CCGAAUGCAUGAAGCAUGUU, CUUGAGCGCCUAUGACUUGUU)8 (link), and a non-targeting control were obtained from Dharmacon. For RNAi rescue experiments withLGN, a single siRNA (GAACUAACAGCACGACUUA) was used and target sequence on the plasmid was mutated to be insensitive to this siRNA.
RNAi experiments were conducted using RNAi MAX transfection reagent (Invitrogen) according to the manufacturer’s guidelines. Pools of 4 pre-designed siRNAs against LGN-GPMS2 (GAACUAACAGCACGACUUA, CUUCAGGGAUGCAGUUAUA, ACAGUGAAAUUCUUGCUAA, UGAAGGGUUCUUUGACUUA), p150-DCTN1 (CUGGAGCGUGUAUCGUAA, GAAGAUCGAGAGACAGUUA, GCUCAUGCCUCGUCUCAUU, CGAGCUCACUACUGACUUA), DHC-DYNC1H1 (GAUCAAACAUGACGGAAUU, CAGAACAUCUCACCGGAUA, GAAAUCAACUUGCCAGAUA, GCAAGAAUGUCGCUAAAUU), siRNAs targeting NuMA (GGCGUGGCAGGAGAAGUUCUU)9 (link) the three Gαi isoforms (CCGAAUGCAUGAAGCAUGUU, CUUGAGCGCCUAUGACUUGUU)8 (link), and a non-targeting control were obtained from Dharmacon. For RNAi rescue experiments withLGN, a single siRNA (GAACUAACAGCACGACUUA) was used and target sequence on the plasmid was mutated to be insensitive to this siRNA.
