Oligonucleotides were synthesized at the Broad Technology Laboratory (BTL) on a B3 Synthesizer (CustomArray). To each sgRNA sequence, BsmBI recognition sites were appended along with the appropriate overhang sequences (underlined) for cloning into sgRNA expression plasmids. Additional primer sites were appended to allow differential amplification of subsets from the same synthesis pool. The final oligonucleotide sequence was thus: 5’-[Forward Primer]CGTCTCACACCG[sgRNA, 20 nt]GTTTCGAGACG[Reverse Primer].
Unique primer sets were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (~40 ng), 5 μL of primer mix at a final concentration of 0.5 μM, and 18 μL water. PCR cycling conditions: 30 seconds at 98°C, 30 seconds at 53°C, 30 seconds at 72°C, for 24 cycles.
Primer SetForward Primer, 5’ – 3’Reverse Primer, 5’ – 3’
1AGGCACTTGCTCGTACGACGATGTGGGCCCGGCACCTTAA
2GTGTAACCCGTAGGGCACCTGTCGAGAGCAGTCCTTCGAC
3CAGCGCCAATGGGCTTTCGAAGCCGCTTAAGAGCCTGTCG
4CTACAGGTACCGGTCCTGAGGTACCTAGCGTGACGATCCG
5CATGTTGCCCTGAGGCACAGCCGTTAGGTCCCGAAAGGCT
6GGTCGTCGCATCACAATGCGTCTCGAGCGCCAATGTGACG
The resulting amplicons were PCR-purified (Qiagen), digested with Esp3I (Fisher Scientific) and cloned into either lentiGuide (pXPR_003, Addgene 52963) or lentiCRISPRv2 (pXPR_023, Addgene 52961). The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30°C for 16 hours on agar with 100 μg/mL carbenicillin. Colonies were scraped and plasmid DNA (pDNA) was prepared (HiSpeed Plasmid Maxi, Qiagen). To confirm library representation and distribution, the pDNA was sequenced by Illumina. After mapping of Illumina reads (see below) we calculated the overall fraction of reads that contained intended sgRNAs, which serves as a surrogate for the quality of the oligonucleotide synthesis. By this cloning scheme, only 21 nts of the synthesized oligonucleotide, the prepended G and the 20 nt variable sequence, become incorporated in the final library, in contrast to ligation-independent cloning schemes (e.g. Gibson) in which both the sgRNA and flanking sequences are derived from synthesis. We deem a library to have passed quality control if > 85% of the sequencing reads map to an intended sgRNA, which corresponds to an oligonucleotide synthesis error rate of 0.75% per base or lower (85% = 211-0.0075). A distribution of sgRNA abundance for the subpools, as well as GeCKOv2 for comparison, is given in Supplementary Figure 2.