Recombinant Protein Expression and Purification

Genscript supplied the sequences in pUC57 vector. The genes were amplified using forward CGGGATCCATGGAAGAAAAGGTAGTG and reverse CGGAATTCTCAATCTTTTTGAGATGAAT primers for BmHAT and forward CGGGATCCATGGAAGAAAAGGTAGTG and reverse CCCGAATTCTTAATGTTTCTCAAAATATGCTTT primers for BmHAX with restriction sites for BamHI and EcoRI. The PCR amplified products were cloned into pRSETA expression vector, transformed into competent BL21 (DE3) E. coli cells for expression of the recombinant proteins with 6X histidine tag as described previously (Dakshinamoorthy et al. 2013c (link)). Recombinant fusion proteins were purified using immobilized metal affinity Ni⁺ charged sepharose column (GE Healthcare Life Sciences, Pittsburg, PA) and eluted with 50 mM–300 mM imidazole. Endotoxin in the final purified protein preparation was removed using an endotoxin removal column (Thermo Fisher Scientific, Rockford, IL). The expression and purity of recombinant proteins were checked in 12% SDS PAGE gel and western blot using anti-his antibodies (Qiagen, Valencia, CA). Protein concentration was determined using a Bradford reagent (Thermo Fisher Scientific).