Quantitative RT-PCR Analysis of FASTKD Genes

qRT-PCR was carried out using total RNA extracted from cells using TRIzol (Invitrogen). One ug of RNA was treated with DNase1 (Fermentas), and reverse transcribed with random hexamers using a cDNA kit (Applied Biosystems) according to manufacturer's protocol. Specific PCR products were amplified using the FASTKD2 PCR primers [5 (link)] (forward primer, TCCTGAATCCCTAAACATGAAAA; reverse primer, GCCATAACTTCCACGAACTG), a 1:50 dilution of cDNA, and the Maxima SYBR Green/Fluorescein qPCR Master Mix (Fermentas). Forward and reverse primers for qRT-PCR of the other 4 FASTKD mRNAs (FASTKD1,3,4,5,) were as previously described [12 (link)]. SYBR green signals were measured in a BioRad iCycler machine. The values were normalized to an internal 18S ribosomal RNA control.