RNA was extracted from Achilles tendons using Trizol/chloroform. cDNA was synthesized by reverse transcription using the SuperScript VILO master mix (Cat. # 11755050, Invitrogen). The TaqMan Array Mouse Immune Panel (Cat. # 4414079, Thermo Fisher) with Taqman Fast Advanced Master Mix (Cat. # 4444556, Thermo Fisher) was used to screen 92 genes related to immune response. Gene expression was normalized to Gapdh and analysed using the 2−ΔΔCt method relative to uninjured control tendons. qPCR was carried out by Mount Sinai’s core facilities using SYBR PCR Master Mix (Cat. # 4309155, Thermo Fisher) and gene expression calculated using the 2−ΔΔCt method relative to Gapdh and carrier-treated control tendons at D3. Primers for Il1β (FWD: AGTTGACGGACCCCAAAAGAT; REV: GTTGATGTGCTGCTGCGAGA) and Il10 (FWD: ATTTGAATTCCCTGGGTGAGAAG; REV: CACAGGGGAGAAATCGATGACA) were used. Tendon gene primers were previously described (7 (link)).
Protocol detail
Achilles Tendon Immune Response
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
SuperScript VILO master mix
TaqMan Array Mouse Immune Panel
Taqman Fast Advanced Master Mix
SYBR PCR Master Mix
Achilles tendons
Cdna
Chloroform
Gapdh
Gene
Gene expression
Il10
Il1β
Immune response
Mouse
Primers
Reverse transcription
Tendon
Trizol
Corresponding Organization :
Other organizations : Icahn School of Medicine at Mount Sinai
Top 5 similar protocols
Variable analysis
independent variables
- Injury/uninjured condition
- Gene expression of 92 genes related to immune response, normalized to Gapdh
- Gene expression of Il1β and Il10, normalized to Gapdh
- Gapdh expression for normalization
- Carrier-treated control tendons at Day 3
- Positive control: Uninjured tendon samples
- Negative control: Carrier-treated control tendons at Day 3
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!