For each sample, we performed three separate 10 μL PCR reactions to reduce PCR bias (Sickel et al., 2015 (link)) using the primers ITS2F [ATGCGATACTTGGTGTGAAT; Tm 61°C (Chen et al., 2010 (link))] and ITS4R [TCCTCCGCTTATTGATATGC; Tm 60°C (White et al., 1990 (link))]. Each reaction contained 0.3 μL FastStartTaq Polymerase (5 U/μL, Roche, Mannheim, Germany), 0.5 μL dNTPs (0.5 mM), 0.75 μL of each forward and reverse primer (10 pmol/μL), 2.5 μL 10× PCR buffer with MgCl2 at a concentration of 20 mM (Roche, Mannheim, Germany), 19.2 μL PCR grade water, and 1 μL DNA template. The PCR conditions were optimized to the following conditions: initial denaturation at 95°C for 10 min, 37 cycles of denaturation at 95°C for 40 s, annealing at 49°C for 40 s, and elongation at 72°C for 40 s. Final extension was performed at 72°C for 5 min.
All reactions were checked for successful amplifications and contaminations by gel electrophoresis (1.5% agarose gels stained with ethidium bromide, 120 V for 30 min). Triplicate PCR products were pooled per sample and purified using the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany).
All reactions were checked for successful amplifications and contaminations by gel electrophoresis (1.5% agarose gels stained with ethidium bromide, 120 V for 30 min). Triplicate PCR products were pooled per sample and purified using the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany).
Free full text: Click here
