Generation of Piggyback-Transduced PGP1 hiPS Cell Line

The Personal Genome Project hiPS cell line PGP1 (56 (link)) was a gift from George Church (https://www.encodeproject.org, accession number: ENCBS368AAA). The cells were cultured on Matrigel-coated wells (Corning, 354277) in mTeSR1 medium (STEMCELL Technologies, 85850) and passaged in the presence of ROCK Inhibitor InSolution Y-27632 (MilliporeSigma, 688001). The 4D-Nucleofector System (Lonza) was used to electroporate piggyBac and transposase vectors into PGP1 cells in suspension (X-Unit, P3 Primary Cell 4D-Nucleofector X Kit L, program CB-156) following the manufacturer’s protocol. After nucleofections, cells were selected with 20 μg/mL Bla (Thermo Fisher Scientific, A1113903) for 5 days. The selected cells were seeded at low densities and propagated until each single cell formed a colony. Colonies were selected and genotyped using primers specifically binding to rod and cone reporter cassettes. The monoclonal cell line carrying both reporter cassettes (PGP1dR) at passage numbers 33–38 was used for all further experiments. The primer sequences were as follows: hRHO forward, GGATACGGGGAAAAGGCCTCCACGGCCACTAGTAGTTAATGATTAACCCG; hRHO reverse, GACGTCCTCGGAGGAGGCCATGGTGGCTGCAGAATTCAGGGGATGACTCT; mCAR forward, CTGGGGGGATACGGGGAAAAGGCCTCCACGGCCACTAGTGGTTCTTCCCATTTTGGCTAC; mCAR reverse, GAACAGCTCCTCGCCCTTGCTCACCATGGTGGCTCTAGACCTCCAGCTCTGGTTGCTAAGCTGGC.