The first step to generating the constructs used here was to create a Puc118-NanoLuc construct without a 5′ UTR (Additional file 2 ). Using In-fusion cloning the 5′ UTR and firefly luciferase enzyme from the EBA175-Firefly plasmid used previously [5 (link), 10 (link)] were replaced with the NanoLuc Luciferase (Promega) coding sequence. The plasmid generated, called P16, consists of: Puc118 backbone with a T7 promotor proceeding the NanoLuc Luciferase protein coding sequence followed by the 3′ UTR from PF_HRP2.
To create the varying length 5′ UTR constructs, the 5′ UTR sequences of PF3D7_1411400 and PF3D7_1428300 were amplified from P. falciparum W2 strain gDNA using Kapa 2G Robust DNA polymerase (Roche KK5024) with primers containing overhangs with the T7 promoter (forward primer) or NanoLuc (reverse primer). The P16 plasmid was amplified using Phusion polymerase (NEB M0530S) for the backbone (forward primer: ATGGTCTTCACACTCGAAGATTTC, reverse primer: CCTATAGTGAGTCGTATTAGAATTCG). The inserts and backbone were purified using a Zymo DNA Clean and Concentrator-5 (Zymo Research D4013). In-fusion reactions were performed per the In-fusion Cloning Kit (Takara 638918) instructions and reactions were transformed into Stellar Competent Cells (Takara 636766).
To create the varying length 5′ UTR constructs, the 5′ UTR sequences of PF3D7_1411400 and PF3D7_1428300 were amplified from P. falciparum W2 strain gDNA using Kapa 2G Robust DNA polymerase (Roche KK5024) with primers containing overhangs with the T7 promoter (forward primer) or NanoLuc (reverse primer). The P16 plasmid was amplified using Phusion polymerase (NEB M0530S) for the backbone (forward primer: ATGGTCTTCACACTCGAAGATTTC, reverse primer: CCTATAGTGAGTCGTATTAGAATTCG). The inserts and backbone were purified using a Zymo DNA Clean and Concentrator-5 (Zymo Research D4013). In-fusion reactions were performed per the In-fusion Cloning Kit (Takara 638918) instructions and reactions were transformed into Stellar Competent Cells (Takara 636766).
Free full text: Click here
