Two numbering systems are used for EGFR. The first denotes the initiating methionine in the signal sequence as amino acid −24. The second, used here, denotes the methionine as amino acid +1. Commercial suppliers of antibodies, such as the Y1068-specific anti-phospho-EGFR, use the first nomenclature. To be consistent, we consider Y1068 as Y1092. Likewise, the T790M mutation reported here has also been called T766M. Mutations were introduced into full-length wild-type and mutant
EGFR cDNAs using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, United States) and cloned into expression vectors as described [3 (
link)]. The following primers were used to generate the deletion (del) L747–E749;A750P mutant: forward 5′-
TAAAATTCCCGTCGCTATCAAGGAGCCAACATCTCCGAAAGCCAACAAGG-3′ and reverse 5′-
CCTTGTTGGCTTTCGGAGATGTTGGCTCCTTGATAGCGACGGGAATTTTA-3′. The following primers were used to introduce the T790M mutation: forward 5′-
AGCTCATCATGCAGCTCAT-3′ and reverse 5′-
ATGAGCTGCATGATGAGCT-3′. The L858R mutant cDNA was generated previously [3 (
link)]. All mutant clones were fully re-sequenced bidirectionally to ensure that no additional mutations were introduced. Various EGFRs were transiently expressed in 293T human embryonic kidney cells as published [3 (
link)]. Cells were treated with different concentrations of gefitinib or erlotinib.