Generation and Characterization of RAF1 Fusion Constructs

SRGAP3-RAF1 and QKI-RAF1 constructs were synthesized as Gateway compatible entry clones. Full-length RAF1, QKI and SRGAP3 were purchased as gateway entry clones from PlasmID/Dana-Farber/Harvard Cancer Center DNA Resource Core. Sub-cloning was done to integrate SRGAP3-RAF1, QKI-RAF1, full-length QKI, RAF1 and SRGAP3 into Gateway-compatible N-MYC-tagged pMXs-Puro Retroviral Vector (Cell Biolabs). NIH3T3 and early-passage PMAs were transduced using infection protocol previously described^{18 (link)}. Gateway destination vectors with either an N-terminal MYC or FLAG tag (Invitrogen) were generated for all constructs. Anti-MYC antibody (Invitrogen R951-25, 1:5000) and anti-FLAG antibody (Sigma A8592, 1:10,000) were used to detect tagged-proteins along with anti-CRAF antibody (Cell Signaling #9422).
QKI-RAF1 dimerization mutants were generated by PCR-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAF^R401H dimerization mutants^{35 (link), 36 (link)} in QKI-RAF1 were generated using primers: Forward CGCAAAACACACCATGTGAACA and Reverse CAGAACAGCCACCTCATTCCT. QKI^E48G dimerization mutants^{31 (link)} in QKI-RAF1 were generated using primers: Forward CTGGACGAAGGAATTAGCAGAG and Reverse CAGCCGCTCGAGGTGGTT.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Jain P., Fierst T.M., Han H.J., Smith T.E., Vakil A., Storm P.B., Resnick A.C, & Waanders A.J. (2017). CRAF gene fusions in pediatric low-grade gliomas define a distinct drug response based on dimerization profiles. Oncogene, 36(45), 6348-6358.

Publication 2017

N-MYC-tagged pMXs-Puro Retroviral Vector N-terminal MYC or FLAG tag Anti-MYC antibody anti-FLAG antibody anti-CRAF antibody

Anti antibody Cancer Cell Dimerization Infection Nih3t3 Plasmid Primers Proteins Raf1 Retroviral Site directed mutagenesis Srgap3 Vectors

Corresponding Organization :

Other organizations : University of Pennsylvania, Children's Hospital of Philadelphia

Top 5 similar protocols

Variable analysis

independent variables

SRGAP3-RAF1 and QKI-RAF1 constructs
Full-length RAF1, QKI and SRGAP3
QKI-RAF1 dimerization mutants
RAF1^R401H dimerization mutants
QKI^E48G dimerization mutants

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: None mentioned
Negative control: None mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!