Gene Expression Analysis of Arabidopsis thaliana

The sample data set (Table 1) used for the analysis came from the experiment described below. Arabidopsis thaliana (Col1) plants were grown in the growth chamber at 23°C with 14 hours of light for four weeks. Total RNA was isolated with RNeasy Plant Mini Kit (Qiagen, Inc.) from methyl-jasmonate treated Arabidopsis, alamethecin treated Arabidopsis and control plants, and DNA contamination was removed with an on-column DNase (Qiagen, Inc.) treatment. One microgram of total RNA was synthesized into first strand cDNA in a 20 μL reaction using iScript cDNA synthesis kit (BioRad Laboratories). cDNA was then diluted into 10 ng/μL, 2 ng/μL, 0.4 ng/μL and 0.08 ng/μL concentration series. Three replicates of real-time PCR experiments were performed for each concentration using an ABI 7000 Sequence Detection System from Applied Biosystems (Applied Biosystems). Ubiquitin was used as the reference gene, and the primer sequences for Arabidopsis ubiquitin gene were CACACTCCACTTGGTCTTGCG (F) and TGGTCTTTCCGGTGAGAGTCTTCA (R). The primers for target gene (MT_7) were designed by Primer Express software (Applied Biosystems) and the sequences were CCGCGGTACAAACCTTAATT (F) and TGGAACTCGATTCCCTCAAT (R). MT-7 gene is the Arabidopsis thaliana gene At3g44860 encoding a protein with high catalytic specificity for farnesoic acid [22 ]. Primer titration and dissociation experiments were performed so that no primer dimmers or false amplicons will interfere with the result. After the real-time PCR experiment, Ct number was extracted for both reference gene and target gene with auto baseline and manual threshold.