Generation of BioID Fusion Proteins

The full-length mouse Lmnb1 cDNA was amplified with primers: GCGCAGATCTATGGCGACCGCGACCCCCGTGCA and GCGCGGCGCGCCTCACATAATGGCACAGCTTTTATTC. The Lmnb1 cDNA was cloned into the pcDNA3.1mycBioID plasmid, which was created by Roux et al.18 (link) and was obtained from Addgene. To construct the lentivirus-based vectors, MycBirA* or MycBirA*-Lmnb1 fragments were amplified and cloned into the lentiviral plasmid. To construct the MycBirA*-macroH2A1 vector, human macroH2A1 cDNA was amplified using primers: GGCCGCGGCCGCATGTCGAGCCGCGGTGG, and GGCCGAATTCCTAG TTGGCGTCCAGCTTGG. The macroH2A1 cDNA was cloned into pcDNA3.1mycBioID vector. All constructs were verified by DNA sequencing.