Protocol detail

Single-cell RNA Sequencing of Differentiation

Find Similar Protocols

Drop-seq and DroNc-seq samples for each differentiation time-point were sequenced in a single run, with 150–200 million reads allocated per sample. Sample libraries were loaded at ~1.5 pM concentration and sequenced on an Illumina NextSeq 500 using the NextSeq 75 cycle v3 kits for paired-end sequencing. 20 bp were sequenced for Read 1, 60 bp for Read 2 using Custom Read 1 primer, GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC^{5 (link)}, according to manufacturer’s instructions. Illumina PhiX Control v3 Library was added at 5% of the total loading concentration for all sequencing runs.

Free full text: Click here

Selewa A., Dohn R., Eckart H., Lozano S., Xie B., Gauchat E., Elorbany R., Rhodes K., Burnett J., Gilad Y., Pott S, & Basu A. (2020). Systematic Comparison of High-throughput Single-Cell and Single-Nucleus Transcriptomes during Cardiomyocyte Differentiation. Scientific Reports, 10, 1535.

Publication 2020

NextSeq 500 PhiX Control v3 Library

Library Primer

Top 5 similar protocols

Variable analysis

independent variables

Differentiation time-point

dependent variables

Gene expression

control variables

Sample library loading concentration (~1.5 pM)
Sequencing platform (Illumina NextSeq 500)
Sequencing kit (NextSeq 75 cycle v3 kits)
Sequencing parameters (20 bp for Read 1, 60 bp for Read 2)
Sequencing primer (Custom Read 1 primer)
Presence of Illumina PhiX Control v3 Library (5% of total loading concentration)

positive controls

Illumina PhiX Control v3 Library

negative controls

Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!