Isolation and Analysis of Mouse Liver tRNA[Ser]Sec

Mouse liver total RNA was separated by anion exchange chromatography with DEAE Sepharose Fast Flow (GE Healthcare, Chicago, IL, USA) to obtain crude tRNAs with removal of polysaccharides and rRNA [66 (link)]. Cytoplasmic tRNA^[Ser]Sec was isolated from the crude tRNAs by reciprocal circulating chromatography, as described in [48 (link)]. The 5′-EC amino-modified DNA probe (Sigma-Aldrich, St. Louis, MI, USA), TGGGCCCGAAAGGTGGAATTGAACCACTCTGTCGCTAGAC was covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare, Chicago, IL, USA). About 6 μg of tRNA^[Ser]Sec were obtained from 1.4 mg crude tRNAs. Mouse tRNA^[Ser]Sec was digested by RNase T1 (Thermo Fisher Scientific, Waltham, MA, USA), and subjected to capillary liquid chromatography (LC) coupled to nano electrospray (ESI)/mass spectrometry (MS) on a linear ion trap-Orbitrap hybrid mass spectrometer (LTQ Orbitrap XL; Thermo Fisher Scientific, Waltham, MA, USA), as described in [49 ,50 (link)]. The RNA fragments were scanned in a negative polarity mode over a range of m/z 600–2000.