The ascidian larvae were fixed in 4% paraformaldehyde for 2 h at RT. In situ hybridization was performed as previously described (Zhang et al., 2018 (link)). Labeled antisense RNA probes were transcribed from linearized DIG RNA Labeling Mixture (Roche America) according to the manufacturer’s instructions. The Lefty probe size is 780 bp, and the sequences of primers are as follows: forward primer, 5′ TTATCGTCCTGTTCCTCGCA 3′ and reverse primer, 5′ GCTGGTTCCTTCACGTTTGT 3′.
Free full text: Click here
