CRISPR sgRNAs for Acipenser ruthenus dnd1

Five single guide RNAs (sgRNAs) were designed to target Acipenser ruthenus dnd1 (Ardnd1) gene. Target sites were, sgSRNA1: GGGGGGAATGCAGTCCAACC; sgRNA2: GGGGGAATGCAGTCCAACC; sgRNA3: TTCAATCATTTTCTTTCTTA; sgRNA4: TGGTTTAAAACCGTAAAGAT and sgRNA5: ATTTTCTGAGTCCATGTTTC. Oligos for sgRNAs were ordered from Macrogen Company (Macrogen Inc., Amsterdam, the Netherlands) and were annealed according to references [41 (link),42 (link)] (Figure S1). In vitro transcription (IVT) using HiScribeTM T7 High Yield RNA synthesis kit (NEB) was used to generate sgRNAs, according to manufacturers’ instructions. Synthesized sgRNAs were treated with DNAse to remove any remaining DNA traces and mySPEC spectrophotometer (VWR^® mySPEC spectrophotometer) was used for sgRNAs quantification. All sgRNAs were diluted and aliquoted. Cas9 protein was purchased from PNA Bio and was re-suspended as per manufacturers’ instructions, aliquoted and stored at −80 °C.