GPCR Gene Amplification and dsRNA Synthesis

Primers containing GPCR gene sequences and T7 polymerase promoter (TAATACGACTCACTATAGGG) at the 5′-end of both the forward primer and reverse primer were used to amplify a 200–600 bp region of the gene coding for each GPCR as reported previously27 (link). The PCR product was used as a template for dsRNA synthesis using the Ambion MEGAscript transcription kit (Ambion, Austin, TX). DsRNA was purified using phenol/chloroform extraction followed by ethanol precipitation and dissolved in nuclease-free water to a concentration of 3–5 μg/μl. The quality of dsRNA was checked by running on an agarose gel and the concentration was measured using NanoDrop1000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA).