Ferret Hematological Profile and Viral Titration

We analyzed for hematological profile and tittered viremia as previously described (17 (link)). Total white blood cell and platelet counts in whole ferret blood samples were analyzed using the Celltac hematology analyzer (MEK-6550J/K, Nihon Kohden, Japan). Total RNA was extracted with TRIzol reagent (ThermoFisher) and reverse-transcribed to generate cDNA using QuantiTect Reverse Transcription system (Qiagen). Primers for real-time RT PCR (F: AATTCACATTTGAGGGTAGTT), R: TATCCAAGGAGGATGACAATAAT) were designed to recognize M segment of DBV genome. Real-time PCR was performed with SYBR Green supermix and CFX Real-Time PCR detection system (Bio-Rad). Copy numbers were normalized to GAPDH gene.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Kim D., Kim E., Kim S., Chung Y., Lai C.J., Cha I., Cho S.D., Choi Y., Dai X., Kim S., Kang S., Kwak M.J., Liu Z., Choi Y., Park S.H., Choi Y.K, & Jung J.U. (2023). Self-assembling Gn head ferritin nanoparticle vaccine provides full protection from lethal challenge of Dabie Bandavirus in aged ferrets. bioRxiv.

Publication Preprint 2023

Celltac hematology analyzer TRIzol reagent QuantiTect Reverse Transcription system SYBR Green supermix CFX Real-Time PCR detection system

Cdna Ferret Gapdh Gene Genome Platelet blood counts Primers Real time pcr Reverse transcription Sybr green Trizol Viremia White blood cell

Corresponding Organization : Institute for Basic Science

Other organizations : Korea Advanced Institute of Science and Technology, Case Western Reserve University, Cleveland Clinic Florida

Top 5 similar protocols

Variable analysis

independent variables

Manipulation of hematological profile and viremia
Extraction of total RNA and generation of cDNA

dependent variables

Total white blood cell count
Platelet count
Copy numbers of M segment of DBV genome normalized to GAPDH gene

control variables

Whole ferret blood samples
Use of Celltac hematology analyzer (MEK-6550J/K, Nihon Kohden, Japan)
Use of TRIzol reagent (ThermoFisher) for RNA extraction
Use of QuantiTect Reverse Transcription system (Qiagen) for cDNA generation
Use of SYBR Green supermix and CFX Real-Time PCR detection system (Bio-Rad) for real-time PCR

controls

Positive control: Not specified
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!