Single-Stranded AAV Vector Production and Characterization

Single-stranded AAV vectors were produced by triple transfection of human embryonic kidney 293 cells and purified by a CsCl-based gradient method (27 (link)). Transgenes used were:

Enhanced green fluorescent protein (GFP) driven by 1) the cytomegalovirus (CMV) early enhancer/chicken beta actin (CAG) promoter; 2) the CAG promoter with the addition of four tandem repeats of the mirT122a sequence (5′CAAACACCATTGTCACACTCCA3′), the mirT1 sequence (5′TTACATACTTCTTTACATTCCA3′) or both, cloned in the 3′ untranslated region of the expression cassette; 3) the short version of the adipocyte protein 2 (mini/aP2) promoter (28 (link),29 (link)); or 4) the short version of the uncoupling protein-1 (mini/UCP1) promoter (30 (link),31 (link));

Hexokinase 2 (HK2) driven by 1) the CMV promoter, 2) the mini/aP2 promoter, or 3) the mini/UCP1 promoter;

Placental-derived secreted alkaline phosphatase (SeAP) driven by the mini/aP2 promoter;

Vascular endothelial growth factor (VEGF)-164 driven by the mini/UCP1 promoter; and

Red fluorescent protein (RFP), driven by the CMV promoter.

A noncoding plasmid carrying the CMV promoter, the mini/aP2 promoter, or the mini/UCP1 promoter and a multicloning site was used to produce null particles.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Jimenez V., Muñoz S., Casana E., Mallol C., Elias I., Jambrina C., Ribera A., Ferre T., Franckhauser S, & Bosch F. (2013). In Vivo Adeno-Associated Viral Vector–Mediated Genetic Engineering of White and Brown Adipose Tissue in Adult Mice. Diabetes, 62(12), 4012-4022.

Publication 2013

Adipocyte Alkaline phosphatase Beta actin Cells Chicken Cscl Cytomegalovirus Embryonic Enhanced green fluorescent protein Hexokinase 2 Human Kidney Placental Plasmid Protein Repeats sequence Transfection Transgenes Ucp1 Uncoupling protein 1 Untranslated region Vascular endothelial growth factor Vectors

Corresponding Organization :

Other organizations : Universitat Autònoma de Barcelona, Centro de Investigación Biomédica en Red Diabetes y Enfermedades Metabólicas Asociadas

Top 5 similar protocols

Protocol cited in 3 other protocols

Variable analysis

Dependent Variables not detected.
Unable to provide accurate variables.

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!