Genomic DNA from cells of interest was obtained using the NucleoSpin Tissue kit (Macherey-Nagel). Genomic DNA was subjected to bisulfite conversion using the EZ DNA Methylation Kit (Zymo Research). The murine TSDR was amplified by PCR containing 100 ng of bisulfite-converted genomic DNA, HotStar Taq PCR buffer (Qiagen), 1 U HotStar Taq DNA polymerase, 2.5 mM MgCl2 and 0.38 µM each of TSDR-for (AAGGGGGTTTTAATATTTATGAGG ) and TSDR-rev (CCTAAACTTAACCAAATTTTTCTACCA ) primer in a final volume of 25 µl (Cycle: 95°C for 15 min; 45×95°C for 30 sec, 57°C for 1 min, 72°C for 1 min; 72°C for 7 min). The PCR product was analyzed by gel electrophoresis. The pyrosequencing procedure was performed on a Pyromark Q96 ID (Qiagen) according to the manufacturer’s protocol, including 40 µl of the PCR product, Pyromark Gold Q96 reagents (Qiagen), Pyromark buffers (Qiagen), Streptavidin Sepharose (GE Healthcare) and the sequencing primers TSDR1 (AACCAAATTTTTCTACCATTA ), TSDR2 (AAAACAAATAATCTACCCC ) or TSDR3 (AATAAACCCAAATAAAATAATATAAAT ). The methylation rate was determined by the Pyromark Q96 software. A rate was excluded if the quality criteria (Pyromark Q96 standard settings) failed for that CpG motif. The methylation rate was translated into a color code as previously described [9] (link).
Free full text: Click here
