Cloning and Knockdown of Neurofibromin

GFP-neurofibromin (type 1 isoform) was cloned in pCDH-EF1a-EGFP-C2-IRES-Puro, a customized vector based on the parental vector pCDH-EF1-EGFP-C2-IRES-Puro from System Biosciences, with expression driven by the EF1a promoter. Cloning details will be presented elsewhere. An expression construct for HA-tagged RASA1 [63 (link)] was kindly provided by Christian Widmann, University of Lausanne, Switzerland. Neurofibromin was stably knocked down in HEK293T cells via lentiviral transduction of a shRNA construct. The targeting sequence GCTGGCAGTTTCAAACGTAA embedded in a miRNA scaffold was cloned into pLV-H1-SGIPZ, a customized lentiviral vector based on pGIPZ vector (Open Biosystems). The resulting pLV-H1-SGIPZ-NF1sh1miR, together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259), were transiently transfected into 293 T cells to produce lentiviral particles. 48 h post-transfection, the supernatant was harvested, filtrated through a 0.45 μM filter and used to infect 293 T cells. 48 h post-infection, puromycin selection was started to obtain the stable cell line. Transient transfections were performed using Polyethylenimine as described [64 (link)]. ON-TARGETplus siRNA-SMARTpool™ siRNAs were transfected using the Saint-Red transfection reagent from Synvolux Therapeutics exactly as described before [65 (link)].