2,2,2-trifluoroethanol (TFE), sodium hydroxide (NaOH), paraformaldehyde (PFA), sucrose, Triton X-100, concentrated hydrochloric acid, sodium carbonate, magnesium sulphate, heparin sodium salt, Limonene and acetic acid were purchased from Sigma-Aldrich. Cx43 Antisense Oligo-deoxynucleotides (asODN, Sequence: GTAATTGCGGCACGAGGAATTGTTTCTGTC) was synthesised by Sigma-Aldrich. 3 ml luer lock syringe and 21-gauge needles were purchased from Becton, Dickinson and Company (BD). Rat-tail type 1 collagen was purchased from Corning. Commercial grade 100% ethanol was purchased from Aik Moh paints and chemicals and diluted to two other concentrations – 70% and 95% with distilled water. Phosphate-buffered saline was purchased at 10x concentration from Bio Basic and diluted to 1x concentration for use in this study (PBS). Tissue-Tek OCT compound was purchased from Sakura Finetek. Haematoxylin and alcoholic eosin Y 515 were purchased from Leica Biosystems. Fluoromount-G was purchased from Abcam. Quant-iT™ OliGreen™ ssDNA Assay Kit, Alexa Fluor 488 goat anti rabbit, Alexa Fluor 555 goat anti mouse, Alexa Fluor 555 goat anti chicken, Alexa Fluor 633 goat anti rabbit, 4′,6-diamidino-2-phenylindole (DAPI) and bovine serum albumin (BSA) were obtained from Life Technologies. Chicken anti-NF200 was purchased from Biolegend. Rabbit anti-glial fibrillary acidic protein (GFAP) was obtained from DAKO. Mouse anti-Ox42 was purchased from Bio-Rad. Neurotrophin-3 (NT-3) was obtained from PeproTech.