Optimized Rat Spinal Cord Tissue Processing
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization : Nanyang Technological University
Variable analysis
- 2,2,2-trifluoroethanol (TFE)
- Sodium hydroxide (NaOH)
- Paraformaldehyde (PFA)
- Triton X-100
- Concentrated hydrochloric acid
- Sodium carbonate
- Magnesium sulphate
- Heparin sodium salt
- Limonene
- Acetic acid
- Cx43 Antisense Oligo-deoxynucleotides (asODN, Sequence: GTAATTGCGGCACGAGGAATTGTTTCTGTC)
- Not explicitly mentioned
- Sucrose
- Rat-tail type 1 collagen
- 100% ethanol, 70% ethanol, 95% ethanol
- Phosphate-buffered saline (PBS)
- Tissue-Tek OCT compound
- Haematoxylin and alcoholic eosin Y 515
- Fluoromount-G
- Quant-iT™ OliGreen™ ssDNA Assay Kit
- Alexa Fluor 488 goat anti rabbit, Alexa Fluor 555 goat anti mouse, Alexa Fluor 555 goat anti chicken, Alexa Fluor 633 goat anti rabbit
- 4′,6-diamidino-2-phenylindole (DAPI)
- Bovine serum albumin (BSA)
- Chicken anti-NF200
- Rabbit anti-glial fibrillary acidic protein (GFAP)
- Mouse anti-Ox42
- Neurotrophin-3 (NT-3)
- Not explicitly mentioned
- Not explicitly mentioned
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!