Achromobacter spp. and A. xylosoxidans Detection

DNA sequences from these candidate loci for all 158 strains (for the Ac assay) and for the 65 A. xylosoxidans strains (for the Ax assay) were extensively assessed for specificity using microbial nucleotide discontiguous megablast (http://blast.ncbi.nlm.nih.gov/). Candidate oligo performance was assessed in silico using NetPrimer (NetPrimer/">http://www.premierbiosoft.com/NetPrimer/) and Beacon Designer (http://www.premierbiosoft.com/qOligo/Oligo.jsp/) using parameters described elsewhere [39 (link)]. The following primers and Black Hole Quencher (BHQ) probes were designed for specific Achromobacter spp. and A. xylosoxidans detection, respectively (5′ to 3′): Ac_F (CACrTAGCTCACGAACTCCAAGC), Ac_R (CAGCTTCAATCCTACCTAACTTTCCT) and Ac_probe (HEX-CGTAGCCGACGGTTTGCAGG-BHQ1), which generates a 144 bp amplicon; and Ax_F (AGCGTCACGGAATGCAGC), Ax_R (AAGGGCGTTTCAACGAGAGC) and Ax_probe (FAM-AGGTCATAGGCGTAGACCAGC-BHQ1), which generates a 127 bp amplicon.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Price E.P., Soler Arango V., Kidd T.J., Fraser T.A., Nguyen T.K., Bell S.C, & Sarovich D.S. (2020). Duplex real-time PCR assay for the simultaneous detection of Achromobacter xylosoxidans and Achromobacter spp.. Microbial Genomics, 6(7), mgen000406.

Publication 2020

NetPrimer Beacon Designer

Achromobacter Assay Dna sequences Nucleotide Oligo Primers Strains

Corresponding Organization :

Other organizations : Sunshine Coast University Hospital, University of the Sunshine Coast, University of Queensland, QIMR Berghofer Medical Research Institute, Prince Charles Hospital

Top 5 similar protocols

Variable analysis

independent variables

DNA sequences from candidate loci for all 158 strains (for the Ac assay)
DNA sequences from candidate loci for the 65 A. xylosoxidans strains (for the Ax assay)

dependent variables

Specificity of candidate oligo performance assessed in silico using NetPrimer and Beacon Designer

control variables

Parameters described elsewhere [39 (link)]

controls

No positive or negative controls were explicitly mentioned.

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!