Caveolin-1 Knockdown in Mouse Cardiomyocytes

MCs (1.2 × 10⁵) were seeded on 24-well plates 24 h prior transfection. Cells were transfected overnight with 80 pmol of siRNA corresponding to human Cav1 bases 403–423 (target sequence: AAGAGCTTCCTGATTGAGATT) or the same amount of control siRNA in 400 μl antibiotic-free medium containing 1 μl Dharmafect 1 (Dharmacon, Lafayette, CO) (Beardsley et al, 2005 (link)). Transfections were repeated after 48 h. 72 h after the last transfection, knockdown efficiency was determined by Western blot and cells were processed as indicated. An alternative Cav1 siRNA was designed (5′-GACGTGGTCAAGATTGACTTT-3′) corresponding to human Cav1 bases 254–277. This sequence was cloned into pLVX-shRNA2, which contains a ZsGreen1 reporter (Clontech, Mountain View, CA). Lentiviral infection was performed as in Goetz et al (2011 (link)). MCs were also infected with pRR-CMV-Cav-IRES-GFP with pLVX-Cav-ZsGreen, or with empty vectors as a control.