Quantifying E-cadherin Expression in Adherent and Suspension Cell Cultures

As described previously [15 (link)], total RNA was extracted from 1.0 × 10⁶ cells using the RNeasy kit (Qiagen) and quantified by spectrophotometry (NanoDrop 8000, Thermo Scientific). In certain experiments, cells were grown in suspension by culturing cells onto poly-hema coated wells for 2h (A549) and 3h (BEAS-2B) prior to RNA extraction. Total RNA was subjected to a one-step real-time RT-PCR using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and cDNA quantification by real-time PCR on the BIO-RAD iQ5 Multicolor Real-Time PCR Detection System using the human E-cadherin (forward primer: AGGCTAGAGGGTCACCGCGTC and reverse primer: GCTTTGCAGTTCCGACGCCAC). The human GAPDH primers (forward primer: CCCACTCCTCCACCTTTGAC and reverse primer: TTGCTGTAGCCAAATTCGTTGT) were used for control. The Real-time PCR experiments were performed at least three times.