HIV-1 serology was determined by HIV Rapid Test Algorithm [54 ] in Tanzania or Alere Determine HIV-1/2 Ag/Ab Combo test in Zambia. The results were further verified in our lab at Lincoln, Nebraska using HIV-1-2.0 First Response kit (Premier Medical Corporation Limited, Daman, India). To quantify HIV-1 plasma viral load, viral RNA was extracted from the plasma according to the QIAamp viral RNA extraction protocol (Qiagen, Hilden, Germany). Viral copy numbers were determined using RNA Ultra-Sense One-Step quantitative RT-PCR system (Applied Biosystems, Carlsbad, CA) as previously described [55 (link)] with universal HIV LTR primers (forward [5’-GCCTCAATAAAGCTTGCCTTGA-3’] and reverse [5’–GGGCGCCACTGCTAGAGA–3’] and probe [5’-FAM/CCAGAGTCACACAACAGACGGGCACA/-BHQ1-3’]) under the following cycling conditions: 50°C for 15 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds, and 60°C for 30 seconds.
Free full text: Click here
