Quantifying miRNA Expression by Northern Blot

Northern blot analysis was performed on the basis of the method that has been previously described, with some modifications (64 (link)). Twenty micrograms of total RNA was separated on 15% tris-borate EDTA (TBE)–urea gels (Bio-Rad, #4566055) and then transferred to a positively charged nylon membrane (Roche, #11209299001). The membrane was cross-linked twice with 254 nm of UV light at 120 mJ/cm² using a CL-1000 UV cross-linker. After prehybridization with 10 ml of ExpressHyb hybridization solution (Clontech) for 40 min at 37°C, the membrane was hybridized overnight with 15 pmol of IRDye-labeled oligonucleotide probes [hsa-miR-17-5p (/5IRD700/ctacctgcactgtaagcactttg), hsa-let-7d-5p (/5IRD700/aactatgcaacctactacctct), RNU43 (/5IRD800/CAGCACACAGTTTCTGTCCGCCCGTC), and RNA5S1 (/5IRD800/cccaggcggtctcccatccaagtactaaccaggcccgaccc)] in 10 ml of ExpressHyb solution at 37°C. The membrane was washed twice with 2× SSC and 0.1% SDS and once with 1× SSC and 0.1% SDS (10 min at room temperature for each) and visualized using the Odyssey CLx Imaging System followed by quantification using Image Studio software.