Quantification of Schistosoma mansoni Sugar Transporter Expression

Total RNA was isolated from the different stages of S. mansoni with TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. Complementary DNAs (cDNA) were obtained by reverse transcription of total RNA using the Thermoscript RT-PCR System (Invitrogen, Carlsbad, USA). The cDNAs were then used as templates in triplicate assays for RT-PCR amplification using the KAPA SYBR FAST ABI Prism kit (Kapa Biosystems, Boston, USA), and ABI PRISM 7000 sequence detection system. We used previously reported primers for S. mansoni sgtp1 and sgtp4 [5 (link)]. The primers for sgtp2 and sgtp3 were designed for this study: sgtp2F 5’ TTTACCTTCGAGGGCAAGAT 3’ and sgtp2R 5’ CACCGCAAGTATGGAATACG 3’, sgtp3F 5’ GCAGCAACTCTCAGGAATCA 3’ and sgtp3R 5’ACACAATAACCGCTCCAACC 3’. The ratios of relative expression were calculated using the 2^-ΔΔCt ratio [46 (link)] with S. mansoni α-tubulin as the endogenous control gene [47 (link)]. The statistical significance between groups was evaluated using the unpaired non-parametric Mann Whitney’s test in the GraphPad 6 Prism program (GraphPad Software Inc.). Differences were considered significant when p-value <0.05.