MH7A cells or primary synovial cells were pretreated with of CIN for 2 h, and then incubated for another 6 h with 10 ng/mL LPS. Total RNAs were isolated using the commercial total RNA miniprep kit (Axygen, USA), according to the manufacturer’s instructions. Each sample was reversely transcribed using the cDNA synthesis kit (TaKaRa, China), by following the manufacturer’s protocol. The primer sequences were used for real-time PCR as shown in Table 1. Real-time PCR was performed using SYBR Green PCR Premix Ex Taq II reagents (TaKaRa) on a Light Cycler 480 II real-time system (Roche, USA), with GAPDH serving as house-keeping gene for normalization [25 (link)].

Primer sequences for real-time PCR

GeneForward primer (5′ → 3′)Reverse primer (5′ → 3′)
IL-6CCTGACCCAACCACAAATGCATCTGAGGTGCCCATGCTAC
IL-8GGTGCAGTTTTGCCAAGGAGTTCCTTGGGGTCCAGACAGA
TNF-αCCCCAGGGACCTCTCTCTAATCGGTTTGCTACAACATGGGCTACA
GAPDHGGAGTCCACTGGCGTCTTAGGCTGTTGTCATACTTCTCAT
Free full text: Click here