Loquat Transcriptional Profiling via qPCR

Total RNA and cDNA for different tissues and developmental stages of loquat were prepared according to the protocol described by Zeng et al. (2015) (link). For Real-time PCR, gene specific primers were designed using Primer3 (vision 0.4.0)¹. The specificity of these primers was determined by examining the melting curve and product resequencing. All reactions were normalized using the Ct value corresponding to the loquat actin gene EjACT (Fu et al., 2012 (link)). Primers for EjODO1 were as follow: forward 5′- ATTCCCCAAGCAATGAGTCTCAG-3′; reverse 5′- TGCTAAGCTATTCTCCTCCGTTGG -3′. Real-time PCR analysis was performed with a LightCycler 1.5 instrument (Roche) using a mixture (10 μl total volume) comprising 2 μl of 5 × LightCycler FastStart DNA Master^PLUS SYBR Green I Master Mix (Roche), 0.5 μl of each primer (10 μM), 1 μl of diluted cDNA and 6 μl PCR-grade H₂O. The PCR conditions included an initial denaturation for 5 min at 95°C, followed by 45 cycles of 95°C for 5 s, 60°C for 5 s, and 72°C for 10 s, and completed with a melting- curve analysis program. Three biological replicates were included for each sampling point or tissue.