Cloning Truncated GRP78 Mutants

DNA fragments encoding different truncated GRP78 mutants were amplified from the plasmid PLVX-GRP78-AcGFP, which was previously constructed in our lab41 (link). Primers (T500: 5′-CCGCTCGAGATGAAGCTCTCCCTGGTGGCCGC-3′, 5′-CGCGGATCCCGCAACTCATCTTTGGTGACTTCAATCTGTGG-3′; T280: CCGCTCGAGATGAAGCTCTCCCTGGTGGCCGC, CGCGGATCCCGCAACTCATCTTTTTTCCTGACATCTTTGCC) introducing XhoI and BamHI restriction sites were used to obtain the target fragments, which were then cloned into pLVX-AcGFP1-N1 (Clontech). Successful cloning was confirmed by sequencing. The PLVX-GRP78-AcGFP-K585Q and -K633Q mutants were constructed using Easy Mutagenesis System from Transgen Biotech (Beijing, China).