CRISPR/Cas9-mediated SIRT7 Knockout in hESCs

CRISPR/Cas9-mediated gene editing (Suzuki et al., 2016 (link)) was performed as previously described (Wang et al., 2020 (link)) with a variety of modifications. In brief, SIRT7 gRNA (CAGCGTCTATCCCAGACTAC) targeting exon 4 of SIRT7 was cloned into gRNA-mCherry vector (SIRT7-gRNA-mCherry). The pCAG-1BPNLS-Cas9-1BPNLS-2AGFP plasmid was purchased from Addgene (#87109). After electroporation, cells were seeded on Matrigel-coated plates and treated with ROCK inhibitor (Tocris) in mTeSR. After 48 h of expansion, dual-positive cells were collected by FACS (BD FACS Aria II) and plated on MEF feeder cells in hESC medium. Emerging clones were manually picked into 24-well plates and then genomic DNAs of the clones were extracted for PCR and sequencing. The corrected hESC clones were homozygous for the addition of base A, resulting in TAA premature termination at both alleles and thus leading to complete knockout of SIRT7. hESC clones were then expanded on Matrigel-coated plates and gene knockout was confirmed by Western blot analysis. Primer sequences are shown in Table S1.