Anti-TOM20 mouse monoclonal antibodies (Cat# ab56783, Abcam, and Cat# sc-17764, Santa Cruz Biotechnology), anti-Calnexin (Cat# ab22595, Abcam), and anti-Calreticulin (Cat# ab2907, Abcam) were used for immunocytochemistry experiments for 1:50–1:200. For immunostaining, Alexa Fluor 568 or 647 conjugated goat anti-mouse IgG (Cat# A-11004 and Cat# A-21236, Molecular Probes) and Alexa Fluor 647 conjugated goat anti-rabbit IgG (Cat# A-21244, Molecular Probes) were used as secondary antibodies for 1:200.
pT7-CalfluxVTN, which was a gift from Carl Johnson (Addgene plasmid # 83926)27 (link), was served as the template to design MAM-Calflux. A 173 aa N-terminal fragment of Venus domain of CalfluxVTN, VN173, was conjugated with a 103 aa linker and the ER-targeting sequence (mSac1 521–587 aa) at its C-terminus. A fragment containing the C-terminal part of Venus, VC155, and following Troponin C and NanoLuc domains was conjugated with the mitochondria-targeting sequence (mAkap1 1–30 aa) and a 57 aa linker at its N-terminus. Sec61b-mCherry was a gift from Gia Voeltz (Addgene plasmid # 49155)72 (link). pCMV R-CEPIA1er was a gift from Masamitsu Iino (Addgene plasmid # 58216)29 (link). The core sequence of human MFN2 shRNA was GGAAGAGCACCGTGATCAATG73 (link).
pT7-CalfluxVTN, which was a gift from Carl Johnson (Addgene plasmid # 83926)27 (link), was served as the template to design MAM-Calflux. A 173 aa N-terminal fragment of Venus domain of CalfluxVTN, VN173, was conjugated with a 103 aa linker and the ER-targeting sequence (mSac1 521–587 aa) at its C-terminus. A fragment containing the C-terminal part of Venus, VC155, and following Troponin C and NanoLuc domains was conjugated with the mitochondria-targeting sequence (mAkap1 1–30 aa) and a 57 aa linker at its N-terminus. Sec61b-mCherry was a gift from Gia Voeltz (Addgene plasmid # 49155)72 (link). pCMV R-CEPIA1er was a gift from Masamitsu Iino (Addgene plasmid # 58216)29 (link). The core sequence of human MFN2 shRNA was GGAAGAGCACCGTGATCAATG73 (link).
Free full text: Click here
