Quantifying Mitochondrial DNA in Photoreceptors

PS and ONL samples were prepared from 2.5-months-old $ro{d}^{\Delta Vhl}$ (N = 6) and control (N = 6) mice using the ReLayS method [43 (link)] as described above. Tissue was lysed by proteinase K (Sigma-Aldrich, 03115879001) treatment at 56 ${}^{\circ }$ C for 45 min with shacking at 300 rpm and RNase A (100 mg/ml; Thermo Fisher Scientific, 12091021) was added to the samples. DNA isolation was performed with QIAamp DNA Blood Mini Kit (Qiagen, 51104) according to manufacturer instructions. DNA from PS and ONL samples was pooled together to obtain DNA samples from photoreceptors. Relative quantification of mtDNA levels was determined by the ratio of the mitochondrial ND1 (mt-Nd1) gene to the nuclear-encoded 18S rRNA gene using real-time PCR. 16 ng DNA was used as template and the genes of interest amplified using the PowerUp SYBR Green Master Mix (ThermoFisher Scientific) in the ABI QuantStudio 3 system (ThermoFisher Scientific) and specific primer pairs: ND1 fwd 5’-3’: CTAGCAGAAACAAACCGGGC and ND1 rev 5’-3’: CCGGCTGCGTATTCTACGTT; 18S rRNA fwd 5’-3’: CGCGGTTCTATTTTGTTGGT and 18S rRNA rev 5’-3’: AGTCGGCATCGTTTATGGTC. Data analysis was carried out using the 2 ${}^{\wedge }$ -ddCt method [98 (link)].