Quantitative Gene Expression Analysis

RNA was extracted from MCF10-MycER and Tet-21/N cells using EuroGold Trifast (EuroClone, Milan, Italy). cDNA was generated using Quantitec Reverse Transcription Kit (Qiagen, Hilden, Germany), according to manufacturer’s protocol. Quantitative analysis was performed using SYBR Green 2X PCR Master Mix (Applied Biosystem, Forster City, CA, USA). Each sample was run in triplicate and normalized to the expression of housekeeping beta-glucoronidase (GUS) gene as previously described.^{46 (link)} The primers used in qPCR are: AKAP1, TTCTCTGCCGATGACATCCT and CATTGACCTGGTTGACC ACA; GUS GGAATTTTGCCGATTTCATGA and CCGAGTGAAGATCCCCTTTTT.

Free full text: Click here

Rinaldi L., Sepe M., Delle Donne R., Conte K., Arcella A., Borzacchiello D., Amente S., De Vita F., Porpora M., Garbi C., Oliva M.A., Procaccini C., Faicchia D., Matarese G., Zito Marino F., Rocco G., Pignatiello S., Franco R., Insabato L., Majello B, & Feliciello A. (2017). Mitochondrial AKAP1 supports mTOR pathway and tumor growth. Cell Death & Disease, 8(6), e2842-.

Publication 2017

EuroGold Trifast Quantitec Reverse Transcription Kit SYBR Green 2X PCR Master Mix

Cdna Cells Housekeeping gene Primers Reverse transcription Sybr green

Corresponding Organization :

Other organizations : Federico II University Hospital, Istituto Neurologico Mediterraneo, Biogem, Istituto Nazionale Tumori IRCCS "Fondazione G. Pascale"

Top 5 similar protocols

Variable analysis

independent variables

MCF10-MycER
Tet-21/N

dependent variables

Gene expression

control variables

Housekeeping beta-glucoronidase (GUS) gene

controls

Positive control: Not specified
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!