All chemicals and drugs were obtained from Sigma-Aldrich, if not otherwise stated. Bradykinin was purchased from Abcam. 3,5-bis(trifluoromethyl)pyrazole (BTP2) a TRPC channel blocker was obtained from Santa Cruz. Rat angiotensin II type 1 receptor, AT1R, with Venus fused at C-terminus was used for Ca2+ experiments [15 (link)]. The HA-tagged AT1R was made by insertion of PvuI restriction site through mutagenesis in the first extracellular loop between Pro331 and Phe332. Agilent QuikChangeII Site-Directed Mutagenesis kit together with the following primers were used: sense 5′ – GGTGATTGCCGAACGATCGGGGCCAGCGGTAC and antisense 5′ GTACCGCTGGCCCCGATCGTTCGGCAATCACC. The product was digested with PvuI (Thermo Scientific), and RSYPYDVPDYARS (Hemaglutinin flanked by PvuI sites) was inserted through ligation (Phusion Hot Start II, ThermoFisher). Structure of the construct was verified by using BigDye® Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). pGβ-2A-YFP-Gγ2-IRES-GαqmTq [16 (link)] was kindly provided by the lab of Th. W. J. Gadella and used for Gαq-Gβγ FRET (Förster Resonance Energy Transfer) measurements.
Free full text: Click here