Chromatin Immunoprecipitation: c-Myc and MYCN

Chromatin assays were performed as described.^{46 (link)} In brief, 1 × 10⁶ cells were cross-linked using formaldehyde to a final concentration of 1% and the reaction was stopped by adding 0.125M Glycine. Cell pellet was resuspended in Cell Lysis Buffer and after 6000 r.p.m. centrifugation RIPA buffer were added to perform nuclei lysis. DNA shearing was conducted by sonication using Bioruptor (Diagenode, Serainge, Belgium). A small aliquot of sonicated material was put aside and remaining sample immunoprecipitated using 5 micrograms of following antibodies: anti-c-Myc (N262) and anti-MYCN (B8.4.B) from Santa Cruz. Rec-sepharose Protein A or G beads (Invitrogen) were used to immobilize immunocomplexes and after RNAse-A treatment (37 °C 1 h) reverse cross-linking were performed using Proteinase K (Roche) for 6 h at 65 °C. Immunoprecipitated DNA was purified using Phenol/Chloroform and Ethanol precipitation techniques. DNA was analyzed by qPCR using the following primers: GGTTGACCCTTCGAGACAAG and CAACCGGAGGAACCTTGAT.