Heat-Inducible Misexpression of Zebrafish Genes

Full-length coding sequences were amplified from SSIII cDNA (Thermo Fisher) using Primestar-GXL polymerase (Takara) and the following primers: fgf20a 5′-AAGCAGGCTCACCATGGGTGCAGTCGGCGA; 5′- GACTGCACCCATGGTGAGCCTGCTTTTTTGTACAAACTTGG; pdgfaa 5′- GCAGATATAAGGTGCGCCAGCGTCACCCA, 5′-CGCGGTTCTCATGGTGAGCCTGCTTTTTTGTACAAACTTGG. Coding sequences were cloned into a hsp70l heatshock misexpression vector from Aman et al., 2018 (link) using NEBuilder HiFi DNA Assembly Master Mix (NEB). Zygotes were injected and raised to 8.5 SSL and given 6 × 1 hr 41°C heatshocks per day for 7 d in a modified Aquaneering rack. Only individuals with epidermal basal cell expression were selected for analysis.

Free full text: Click here

Aman A.J., Saunders L.M., Carr A.A., Srivatasan S., Eberhard C., Carrington B., Watkins-Chow D., Pavan W.J., Trapnell C, & Parichy D.M. (2023). Transcriptomic profiling of tissue environments critical for post-embryonic patterning and morphogenesis of zebrafish skin. eLife, 12, RP86670.

Publication 2023

SSIII cDNA Primestar-GXL polymerase NEBuilder HiFi DNA Assembly Master Mix

Aman Cdna Coding sequences Epidermal cell Heatshock Primers Vector Zygotes

Corresponding Organization :

Other organizations : University of Virginia, University of Washington, National Human Genome Research Institute, National Institutes of Health

Top 5 similar protocols

Variable analysis

independent variables

Heat shock treatment: 6 × 1 hr 41°C heatshocks per day for 7 d

dependent variables

Epidermal basal cell expression

control variables

Zygotes injected and raised to 8.5 SSL
Only individuals with epidermal basal cell expression were selected for analysis

controls

Positive control: Not explicitly mentioned.
Negative control: Not explicitly mentioned.

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!