Genomic DNA from cells was isolated using the QIAamp DNA Mini and Blood Mini kit (51104, Qiagen). DNA concentration and purity were determined with the Cytation 5 reader (Agilent Technologies).
Amplification of GAA repeat expansions in the FXN gene was performed by PCR using primers GAA_F: 5′‐GGCTTGAACTTCCCACACGTGTT and GAA_R: 5′‐A GGACCATCATGGCCACACTT, as previously described (Long et al., 2017 (link)). Reactions utilized the Failsafe PCR System with mix D (FS99100). The thermal cycler was programmed as follows: 94°C for 3 min, 20 cycles of 94°C for 20 s, 64°C for 30 s, and 68°C for 5 min, followed by 9 cycles of 94°C for 20 s, and 68° for 5 min, each subsequent elongation step increased by 15 s. The last step was 68°C for 7 min. The amplification products were resolved on 1% agarose gels stained with SYBR Safe DNA Gel Stain (cat. S33102, Thermo Fisher). The length of an expanded GAA repeat was determined using the base pair size called function, of Image Lab 6.0 (BioRad). The GAA length was calculated by subtracting the length of the PCR primers and GAA flanking sequences from the number of base pairs of the PCR product and dividing the difference by three. [Number of GAA repeats = (length of base pairs of a PCR product−498)/3]The reference sequence used is NG_008845.2.
Amplification of GAA repeat expansions in the FXN gene was performed by PCR using primers GAA_F: 5′‐GGCTTGAACTTCCCACACGTGTT and GAA_R: 5′‐A GGACCATCATGGCCACACTT, as previously described (Long et al., 2017 (link)). Reactions utilized the Failsafe PCR System with mix D (FS99100). The thermal cycler was programmed as follows: 94°C for 3 min, 20 cycles of 94°C for 20 s, 64°C for 30 s, and 68°C for 5 min, followed by 9 cycles of 94°C for 20 s, and 68° for 5 min, each subsequent elongation step increased by 15 s. The last step was 68°C for 7 min. The amplification products were resolved on 1% agarose gels stained with SYBR Safe DNA Gel Stain (cat. S33102, Thermo Fisher). The length of an expanded GAA repeat was determined using the base pair size called function, of Image Lab 6.0 (BioRad). The GAA length was calculated by subtracting the length of the PCR primers and GAA flanking sequences from the number of base pairs of the PCR product and dividing the difference by three. [Number of GAA repeats = (length of base pairs of a PCR product−498)/3]The reference sequence used is NG_008845.2.
